| ID# | Plasmid name | Description | Depositor |
|---|---|---|---|
| 502 | (Myc)2-apm1 | KpnI-myc-BglII-myc-SacI-BamHI-apm1-XhoI-NsiI-myc-stop (in pDXD-3C) No visible structure in IFs. | Nelly Bennett |
| 503 | (Myc)2-apm2 | KpnI-myc-BglII-myc-SacI-BamHI-apm2-stop-XhoI-NsiI... (in pDXD-3C) No visible structure in IFs. | Nelly Bennett |
| 504 | (Myc)2-apm3 | KpnI-myc-BglII-myc-SacI-BamHI-apm3-xhoI-NsiI-myc-stop (in pDXD-3C) No visible structure in IFs. | Nelly Bennett |
| 505 | (Myc)2-apm4 | KpnI-myc-BglII-myc-SacI-BamHI-apm4-stop-XhoI-NsiI... (in pDXD-3C) No visible structure in IFs. | Nelly Bennett |
| 506 | (Myc)2-delta | KpnI-myc-BglII-myc-SacI-BamHI-delta-xhoI-nsiI-myc-stop (in pDXD-3C) No visible structure in IFs. | Nelly Bennett |
| 501 | (Myc)2-VAMP7 | KpnI-myc-BglII-myc-sacI-BamHI-VAMP7-XhoI-NsiI-myc-stop (in pDXD-3C) In IFs, 9E10 labels endocytic compartments and also in some cells the plasma membrane. | Nelly Bennett |
| 385 | ACG-KO | Knockout plasmid for acgA | Karin Weening (Pauline Schaap) |
| 314 | Act 15 ACG | Pauline Schaap | |
| 322 | Act 15 ACG-Y | Pauline Schaap | |
| 514 | act15::[rasC/GFP] | GFP-rasC expression construct under control of the actin15 promoter. | P. Bolourani (G. Weeks) |
| 107 | amiB-KO (p12-3NdeI) | Recapitulation of the R12-3 amiB- REMI mutant (aggregation-minus B) | Yukako Asano (Kazuo Sutoh) |
| 106 | amiB-KO (p82ClaI) | Recapitulation of the R8-2 amiB- REMI mutant (aggregation-minus B) | Yukako Asano (Kazuo Sutoh) |
| 460 | arpB-KO | Knockout construct for arpB (blasticidin cassette from pRHI148 was excised as a ClaI fragment and ligated into the BstBI site of arpB) | |
| 202 | atgN-KO | atgN knockout construct containing bsr cassette. | Turgay Tekinay |
| 839 | Blasticidin S resistance cassette | gene replacement construct typically flanked by target DNA and used for homologous recombination, conferring blasticidin S resistance; for curation purpose only | |
| 321 | BS15 | Pauline Schaap | |
| 124 | carB::lacZ | carB-lacZ expression construct | Karl Saxe |
| 56 | cbpA-KO | cbpA (calcium-binding protein 1) gene disruption construct. | Barrie Coukell |
| 15 | cbpJ | cbpJ cDNA in PET15b (CbpJ protein) calcium-binding protein | Barrie Coukell |
| 68 | CRAC-GFP (pWf1) | Full-length cDNA of CRAC was cloned upstream of the start codon of GFP. The resulting CRAC-GFP construct was inserted in the constitutive expression vector B18. | Peter Devreotes |
| 158 | CS4 5.03 | Blasticidin cassette is loxed; plasmid can be used to replace the endogenous NSFA gene with the ts variant, which exists in HM1067. Plasmid is similar to the unloxed version used to generate NSFA2 (Pmid 12183371; d7379). | Mark Bretscher |
| 57 | cupB-AS | cupB (Ca2+/Calcineurin-regulated cup gene) antisense construct. | Barrie Coukell |
| 315 | dimB-KO | dimB knockout vector. | Gad Shaulsky |
| 239 | DIV5 | remi plasmid for uracil selection (not yet available) | Bill Loomis |
| 511 | dmpA::bsr | Remi rescued plasmid from rasC-/dmpA- cells (dmpA knockout vector). | P. Bolourani (G. Weeks) |
| 259 | DNG1-GFP | DNG1-GFP vector | Yasuo Maeda |
| 257 | DNG1-KO | DNG1 knockout vector | Yasuo Maeda |
| 258 | DNG1-OE | DNG1 overexpression vector | Yasuo Maeda |
| 280 | dpoA KO construct | dpoA knockout vector (plasmid rescued with ClaI from REMI mutant HAD172). | Adrian Harwood |
| 492 | DsRed | DsRed expression vector pDG75 (expressing Discosoma sp. Red Fluorescent protein); transformed bacteria are red when grown in LB with ampicillin (75 ?g/ml) and 1 mM IPTG. | David Knecht |
| 344 | ecmA/myc-fbxA | Myc-tagged FbxA under the control of the prestalk ecmA promoter. | Jakob Franke |
| 47 | EcmO-Gal | EcmA PCR'd promoter fragments inserted into BamHI site of A15deltaBam-gal. 5' end, Bam/BglII at -1694. 5' end, BamHI site at variable points. (5' junction of available promoter) | Jeff Williams |
| 357 | EXP5(+) | Integrating expression vector derived from EXP4(+) by removal of the HindIII and XbaI sites, and replacement of the mcs. | Karin Weening (Pauline Schaap) |
| 55 | EXPpatA-AS | patB (Ca2+-ATPase PAT1) antisense construct | Barrie Coukell |
| 104 | FadA-KO | fadA knock-out vector (Bsr cassette inserted in the HindIII site) | Tamao Saito |
| 346 | fbxA/gfp-neo | Plasmid that expresses GFP under the control of the fbxA promoter (in a pTX-GFP background). | Jakob Franke |
| 332 | fbxA/myc-fbxA | Myc-tagged FbxA under the control of the fbxA promoter in a pDXA background. | Jakob Franke |
| 302 | Gα2-CFP | Reporter construct (CFP inserted into the helical domain of Gα2 in a location optimal for FRET). | Jane Borleis (Devreotes) |
| 99 | Gβ-YFP | Reporter construct (YFP fused to NH2-terminal of Gβ). The gene encoding the full-length YFP was fused to the NH2-terminus of the Gβ gene. A BglII restriction site was added at the junction that consisted of two additional amino acids, arginine and serine. This β-YFP fusion protein was cloned into the CV5 vector. CV5 was derived from p88 by addition of an actin 15 expression cassette from pMC34. | Tian Jin |
| 64 | Gγ-YFP | Gγ-YFP construct (unpublished) | Peter Devreotes |
| 108 | GFP-Arp2/pBIG(G418) | The arp2 fragment was subloned into the pBIG plasmid downstream of the actin15 promoter, the GFP coding sequence, and a Gly-Pro-Gly linker sequence, and upstream of the actin15 terminator. | Yukako Asano (Taro Uyeda) |
| 98 | GFP-Gβ | Reporter construct (GFP fused to NH2-terminus of Gβ subunit). The coding region of GFP-Gβ fusion protein was cloned into pMC34, an extrachromosomal expression vector. | Tian Jin |
| 497 | GFP-Syntaxin8 | KpnI-GFP-SacI-BamHI-Syntaxin8-XhoI-NsiI-myc-stop (in pDXD-3C) Decorates the bladders and tubular network of the contractile vacuole. | Nelly Bennett |
| 498 | GFP-VAMP7-stop | KpnI-GFP-SacI-BamHI-VAMP7-stop-XhoI-NsiI-myc-stop (in pDXD-3C) Decorates the endocytic compartments and sometimes the contractile vacuole bladders. The plasma membrane is also decorated in about 10% of the cells. | Nelly Bennett |
| 499 | GFP-VAMP7[L35A]-stop | KpnI-GFP-SacI-BamHI-VAMP7[L35A]-stop-XhoI-NsiI-myc-stop (in pDXD-3C) Decorates the endocytic compartments and sometimes the contractile vacuole bladders. The plasma membrane is decorated in about 70% of the cells. | Nelly Bennett |
| 902 | hygromycin B resistance cassette | gene replacement construct typically flanked by target DNA and used for homologous recombination, conferring hygromycin S resistance; for curation purpose only | |
| 442 | iplA(ins) | iplA knockout vector. | David Lam (Pierre Golstein) |
| 406 | Kdel-neo | Mutated Dd PK2 protein kinase over-expression vector. (K-neo cut with KpnI, blunt-ended with T4-polymerase, and religated) | |
| 316 | lim2- | Kanamycin-resistant limB-knockout vector (in pCR-BluntII-TOPO) with hygromycin-resistance cassette. | Gerti Weijer |
| 840 | loxP-Blasticidin S resistance cassette | gene replacement construct flanked by target DNA and used for homologous recombination; loxP sites on both sides of the Bsr cassette allow removal of the resistance marker when expressing a cre recombinase; for curation purpose only | |
| 246 | LST8-KO | LST8 knockout vector | Rick Firtel |
| 247 | LST8-OE | LST8 overexpression vector | Rick Firtel |
| 292 | lvsB-KO | Knockout vector with bsR cassette for lvsB gene | Arturo De Lozanne |
| 293 | lvsC-KO | Knockout vector with bsR cassette for lvsC gene | Arturo De Lozanne |
| 294 | lvsD-KO | Knockout vector with bsR cassette for lvsD gene | Arturo De Lozanne |
| 295 | lvsE-KO | Knockout vector with bsR cassette for lvsE gene | Arturo De Lozanne |
| 296 | lvsF-KO | Knockout vector with bsR cassette for lvsF gene | Arturo De Lozanne |
| 474 | mars-ABD120 | Vector with a bsR-resistance cassette, expressing a fusion of the actin-binding domain of ABD120 (filamin) and RFP. The plasmid was originally constructed by Annette Mueller-Taubenberger. The sequence was repaired by Dave Knecht (Y218N) | David Knecht (Annette Mueller-Taubenberger) |
| 367 | MF1 | cudA knockout vector obtained from original REMI mutant (using pRHI30) by EcoRI digestion and religation. | Masashi Fukusawa |
| 368 | MF2 | cudA knockout vector containing an internal deletion and bsr cassette. | Masashi Fukusawa |
| 462 | mrrA:lacZ | Complete mrrA upstream promoter region fused to lacZ. | Susan Ross (Jeff Williams) |
| 317 | Myc10 | Pauline Schaap | |
| 845 | neomycin resistance cassette | gene replacement construct typically flanked by target DNA and used for homologous recombination, conferring neomycin (G418) resistance; for curation purpose only | |
| 365 | Nramp1-KO vector | Nramp1 knockout vector | Salvo Bozzaro |
| 224 | p155d1 | 7268-bp Csp451 fragment of Ddp1 in p60. | Carole Parent |
| 218 | p240Cla | erkB knockout vector (2.1-kb and 1.7-kb genomic fragments flanking the remi plasmid DIV6) | Bill Loomis |
| 225 | p60 | Dictyostelium expression vector: 2.3-kb SalI-EcoRI fragment (neoR cassette) of pB10S subcloned into pGEM3Z. | |
| 43 | p6B (CAR1) | Partial cAR1 cDNA in pBlue Script. | Peter Devreotes |
| 86 | pA15 | Peter Devreotes | |
| 631 | pA15-500-myc | Plasmid to drive the overexpression of SOD using the actin 15 promoter; contains C-terminal myc tag. | Catherine Pears |
| 279 | pA15-BSR-aarA-KO | aardvark knockout vector generated by replacing a 600-base-pair ClaI/EcoRI fragment in the aar cDNA with a 1.4-kilobase (kb) ClaI/EcoRI fragment containing a blasticidin-resistance gene expressed from an actin-15 promoter | Adrian Harwood |
| 191 | pA15-PsiA(ORF) | psiA rescue vector, in Exp4(+), under the control of the actin 15 promoter. | Takefumi Kawata |
| 48 | pA15-Rm | (pActRsub-AEBE) Two glycine->glutamic acid mutations in the regulatory subunit of PKA. Overexpression results in inhibition of the catalytic subunit in the presence of cAMP. | Jeff Williams |
| 351 | pA15/aequorin | plasmid containing the aequorin gene under the control of the act15 promoter, G418 resistant; constructed by Robert Insall | Harry MacWilliams |
| 342 | pA15/CFP-Apg1 | Fusion construct of CFP and DdApg1 under the control of the actin 15 promoter (in pDXA-HC). | Grant Otto |
| 339 | pA15/GFP-Apg1 | GFP-Apg1 fusion construct under the control of the actin 15 promoter (in pDXA-HC) | Grant Otto |
| 341 | pA15/GFP-Apg8 | GFP-DdApg8 fusion construct under the control of the actin 15 promoter (in pTX-GFP). | Grant Otto |
| 330 | pA15/myc-fbxa | Myc-tagged FbxA in pDXA background. | Jakob Franke |
| 384 | pA15/paxB-GFP(S65T) | paxillin-GFP expression vector; blasticidin resistance marker | Gerti Weijer |
| 300 | pA15/pHluorin | Cytosolic pH-sensor | Harry MacWilliams |
| 340 | pA15/RFP-Apg8 | RFP-DdApg8 fusion construct under the control of the actin 15 promoter (in RFPmars). Ddatg8 was obtained by PCR with the primers GGGGATCCGTTCATGTATCAA and GGGGATCCTTATAAATCACTA and cloned into the BamHI restriction site of the plasmid RFPmars. | Grant Otto |
| 569 | pA15BSR-pic20HmcsF | act15:BSR vector with the pic20H multiple cloning site inserted in the forward orientation at the 3' end of the act8 terminator | Harry MacWilliams |
| 570 | pA15BSR-pic20HmcsR | act15:BSR vector with the pic20H multiple cloning site inserted in the reverse orientation at the 3' end of the act8 terminator | Harry MacWilliams |
| 311 | pA15lagC | ||
| 468 | pA15TX | ||
| 469 | pA15XPT1 | Sequence note: Complete sequence is 4604 b.p. of pA15XPT1-TERM AT SAL. | |
| 470 | pA6NPTII | Sequence note: Complete sequence is 6678 b.p. | |
| 952 | pAbcC3-REMI | AbcC3 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:796000 | Christopher Quang Dung Dinh/Adam Kuspa |
| 893 | pAbcC9-REMI | abcC9 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:2945237 | Christopher Quang Dung Dinh/Adam Kuspa |
| 868 | pAbcG16-REMI | abcG16 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:2689877 | Christopher Quang Dung Dinh/Adam Kuspa |
| 461 | pACA-KO | Two DNA fragments were amplified using genomic DNA as template. One of the fragments corresponds to the region upstream of the aca open reading frame. The other one corresponds to the region encoding the middle part of the aca open reading frame. The blasticidin cassette was also amplified by PCR and inserted in the middle of both cyclase fragments using the metod of Kuwayama et al. (Pmid 11788728; d7349), and cloned into pCR-BluntII-TOPO. | Satomi Matsuoka (M. Ueda) |
| 87 | pACA.URA | ACA knockout construct | Peter Devreotes |
| 81 | pAcbA-BSR-KO | acbA knockout vector | Bill Loomis |
| 334 | pAcgA-KO-Hygro | knock out vector for the acgA gene with hygromycin resistance. This plasmid was made by Marcel Meima in P. Schapp's lab. It has not been published although an ACG knockout was made with it. | Pauline Schaap |
| 810 | pAct15-alpha-cateninhp | RNAi construct for D. discoideum alpha-catenin (ctnnA). The hairpin is expressed under the control of the actin 15 promoter. | Daniel Dickinson / James Nelson and Bill Weis Lab |
| 117 | pAct15-Gal | Galactosidase expression vector with actin 15 promoter. The XbaI/BglII fragment of the actin 15 promoter was cloned into pdDGal17. | David Knecht |
| 265 | pAct15-Gal | Galactosidase expression vector. The XbaI/BglII fragment of the actin 15 promoter was cloned into pdDGal17. | Adrian Harwood |
| 718 | pAct15/SodA-myc | C-terminal myc-tag/sodA cloned into pAct15-Gal | Catherine Pears |
| 271 | pActin15-GskA | gskA expression vector (actin15::gskA) made by subcloning the gskA cDNA into pDXA-3H (gskA contains C-terminal 6xHistidine tag). | Adrian Harwood |
| 274 | pActin15-Rc | actin15::PKA-Rsubunit (Rc mutant does bind C subunit = control) expression vector. | Adrian Harwood |
| 273 | pActin15-Rm | actin15::PKA-Rsubunit (Rm mutant) expression vector. | Adrian Harwood |
| 272 | pActin15-Rsub1 | actin15::PKA-Rsubunit (wild type) expression vector containing the actin6-neoR cassette. | Adrian Harwood |
| 283 | pActin15StatAcidpep | actin15::StatA containing Ser-Asp GSK3 peptide specific substrate | Adrian Harwood |
| 282 | pActin15StatAlapep | actin15::StatA containing Ser-Ala GSK3 peptide specific substrate | Adrian Harwood |
| 281 | pActin15StatWTpep | actin15::StatA containing WT GSK3 peptide specific substrate | Adrian Harwood |
| 954 | pAdh5-REMI | Adh5 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:5044094 | Christopher Quang Dung Dinh/Adam Kuspa |
| 943 | pAdprh-REMI | Adprh REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:3078245 | Christopher Quang Dung Dinh/Adam Kuspa |
| 855 | pAdprt1B-REMI | adprt1B REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:1745536 | Christopher Quang Dung Dinh/Adam Kuspa |
| 59 | pAK2 | carB-KO construct (car2-::thy) | Karl Saxe |
| 824 | pAmpA-mRFP | The mRFP-AmpA plasmid was constructed so that the AmpA hydrophobic leader sequence (MLNKLILLLILSSCLVLSVKSEV ? predicted cleavage site underlined) preceded the mRFP coding sequence (Fischer et al 2004) which was followed by the remainder of the AmpA coding sequence starting with the amino acid ?N? which immediately follows the hydrophobic leader. A BglII(ampA promoter region) ?Age I (AmpA coding region well C-terminal to the hydrophobic leader) fragment containing the hydrophobic leader-mRFP fused in frame to ampA coding sequence was cloned into the BglII ?AgeI site in a genomic copy of the full length ampA gene in pGem3 (pGem3-C12) to replace the endogenous Bgl II-Age I fragment and the floxed blastocidin cassette from pLPBLP (Kimmel 2006) was inserted in the multiple cloning site at the Pst1-Xma1 site. This plasmid has been introduced as a closed circular plasmid and expresses mRFP-AmpA and gives an overexpresser phenotype. It is necessary to use antibody to detect the fusion protein because the mRFP signal is not strong enough to image live cells. | Jessica Kelsey / Daphne Blumberg |
| 221 | pAmpA/lacZ | ampA promoter-lacZ fusion construct | Daphne Blumberg |
| 817 | pAmpAFB- | Plasmid used to knock out the gene, ampA. Plasmids was constructed with removable floxed bsr cassette and contains a 1000 bp coding region of ampA and another 1500 bp coding region downstream of the first. A 500 bp sequence was left out between the two coding regions. The regions were inserted at EcoRI, HindIII and SpeI, SacII restriction sites into a pBluescript plasmid containing a floxed bsr cassette previously inserted at a SmaI site. | Jessica Kelsey / Daphne Blumberg |
| 873 | pAp2s1-REMI | ap2s1 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:3163840 | Christopher Quang Dung Dinh/Adam Kuspa |
| 1043 | pAS-tdtom-NLSpLD1 | Overexpression of nuclear localization sequence with tandem dimeric tomato fluorophore attached; inserted with Sall and Notl into the pLD1A15SN vector; insert length 1.5 kb; parental vector length 5.7 kb; total insert length 7.2 kb; Dicty resistance marker: neomycin; | Alexandra Surcel (Robinson Lab) |
| 909 | pAslA-1-REMI | AslA-1 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:2719024 | Christopher Quang Dung Dinh/Adam Kuspa |
| 62 | pATψ-BsrR-Rev | Targeting vector for the psiA gene | Takefumi Kawata |
| 312 | pax1- | pax1 knockout vector (in pBLuescript-SKII) containing bsr cassette. | Gerti Weijer |
| 793 | pAX4-tgrB1/tgrC1 | tgrB1/tgrC1 double gene replacement plasmid with tgrB1-AX4 and tgrC1-AX4 alleles, driven by AX4 promoter. Used to insert these alleles into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none (5FOA); parent pGEM3 | Rocio Benabentos (Shaulsky Lab) |
| 798 | pAX4-tgrB1/tgrC1-bsR | tgrB1/tgrC1 Merodiploid plasmid with tgrB1-AX4 and tgrC1-AX4 alleles, driven by AX4 promoter. Used to insert an extra set of tgrB1/tgrC1 alleles randomly in the genome. Bacterial selection: amp; dicty selection: bsR; parent pGEM3 | Rocio Benabentos (Shaulsky Lab) |
| 226 | pB10S | Not available yet. Dictyostelium expression vector containing neoR cassette (actin 6 promoter, Tn5 neomycin resistance gene, actin 8 terminator (in reverse)). | |
| 291 | pB10TP4 | Not available. Same as pB10TP2 except for a modification in the polylinker (JG Williams, pers. commun.) | |
| 1084 | pB17S-EYFP | Vector for expression of proteins with C-terminal EYFP in Dictyostelium. Yellow fluorescence protein under A15 promoter. XhoI/XbaI for YFP exc. Made in C.J. Weijer lab by insertion of EYFP in pB17S of Manstein et al., (Manstein et al., 1995); YFP insert length: ~0.8 kb; total vector length: 6.81 kb | Gillian Forbes (CJ Weijer Lab) |
| 813 | pB17SDdDgcA-YFP | dgcA overexpression vector under the control of the act15 promoter | Zhihui Chen / Pauline Schaap |
| 25 | pB18 | Integrating expression vector. containing the actin6 neo cassette. | Peter Devreotes |
| 487 | pBC18 | Chimeric protein, with the extracellular portion of the contact site A protein fused to the transmembrane domain of the integral protein P29F8 and to the cytoplasmic sequence KTRVSQNSG, in the expression vector pDCEV4. | Francois Letourneur |
| 1074 | pBcas3-KO | Construct used for knockout of DDB_G0272949 (bcas3);5' insert was cloned into pLPBLP with PstI/BamHI and the 3' insert was excised with HindIII/Xhol and inserted into HindIII/SalI digested vector;parent vector: pLPBLP;insert lengths: 1.3 kb + 1.1 kb | Gillian Forbes (Schaap Lab) |
| 1067 | pBeiB/YFP | Reporter construct expressing YFP under control of the beiB promoter; Parental vector: pDV-CYFP; Insert length: 1kb; Total vector length: 8.2kb; Bacteria used: E. coli (XL1-Blue); dictyBase gene: beiB(DDB_G0278537); | Koryu Kim (Schaap Lab) |
| 121 | pBIG | Autonomous replicating extrachromosomal expression vector with G418 castte. | Tom Egelhoff |
| 381 | pBIG-GFP-myo | Expresses mhcA with GFP fused at N-terminus, driven by actin 15 promoter. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 379 | pBIGALA | Expresses mhcA fused to actin 15 promoter, carrying "3xALA" mutation of threonines 1823, 1833, and 2029. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 380 | pBIGASP | Expresses mhcA fused to actin 15 promoter, carrying "3xASP" mutation of threonines 1823, 1833, and 2029. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 998 | pBLS-hephA-bsr | hephA knockout vector in a Bluescript construct | Salvo Bozzaro |
| 386 | pBORP | Expression vector containing neoR cassette. | Rex Chisholm |
| 42 | pBS-ACA | partial ACA cDNA (adenylyl cyclase) in pBlueScript | Peter Devreotes |
| 389 | pBS18/car2 | Karl Saxe | |
| 85 | pBSA15 | A15-neo cassette cloned in pBluescript in its BamHI-EcoRI site. | Peter Devreotes |
| 407 | pBSEGE | The plasmid pBSEGE was rescued from egeA- genomic DNA by circularization of a HindIII fragment. | |
| 471 | pBSR-GFPABD120 | Vector containing a blasticidin resistance cassette, expressing a fusion of GFP and the actin-binding domain of ABD120 (filamin). | David Knecht |
| 208 | pBsr-Nsi-MHCKD-KO | mhkD knockout vector | Tom Egelhoff |
| 601 | pBSR-tgrB1-KO | tgrB1 knock-out plasmid | Rocio Benabentos (Shaulsky Lab) |
| 32 | pBSR1 | REMI plasmid with blasticidin cassette, with the sequence CAACAAGATCTAGAATTAG changed to CAACAAGATCCAGAATTAG to eliminate the internal BglII and XbaI sites to make it more convenient for REMI usage; Sequence note: the sequence below is pBSR3 minus nt 29-50. | Gadi Shaulsky |
| 33 | pBSR3 | REMI plasmid containing blasticidin cassette (SmaI and ApaI sites were introduced in pBSR1 flanking the BamHI site) | Gadi Shaulsky |
| 37 | pBsR479 | ampicillin-resistant vector with bsR cassette | Frantisek Puta |
| 38 | pBsR503 | Kanamycin-resistant vector with bsR cassette | Frantisek Puta |
| 36 | pBsR519 | ampicillin-resistant vector with bsR cassette | Frantisek Puta |
| 414 | pBsrH | Expression vector derived from pDEXH by replacing the neoR cassette with the bsR cassette. | Markus Maniak |
| 1087 | pBSRIICpnAKO | 5' flanking cpnA gene sequence (.9 kb), 3' cpnA flanking sequence (1.5 kb); pLPBLP (4.45 kb); The DNA cpnA knockout construct was made by PCR subcloning of the 5' and 3' flanking sequences of cpnA on either side of the bsr gene into the pBSIIbsr plasmid. A 900-bp fragment upstream of the cpnA gene was PCR amplified from genomic DNA by use of the following primers: 5'-AAAATTTTAACTTCTTCATCATCATCATCT-3' and 5'-GTGAC CAAAATAACCTT-3'. A 1,500-bp fragment downstream of the cpnA gene was PCR amplified from genomic DNA by using the following primers: 5'-GG TGTATCAAATGTATCATTAG-3' and 5'-CAAATGGTGGAAGGGCTTACC-3'; The 902 kb 5' flanking sequence was cloned into the KpnI site of the pBSIIbsr plasmid. | Amber Ide (Cynthia Damer) |
| 14 | pCalA | calA cDNA in PET15b (Dicty calmodulin I) | Barrie Coukell |
| 306 | pCalpHluorin | ER pH-sensor ; the ER marker calreticulin is fused to ratiometric pHluorin. | Harry MacWilliams |
| 70 | pCAR1-B18 | cAR1 over-expression vector | Peter Devreotes |
| 93 | pCAR1-GFP | Jane Borleis (Peter Devreotes) | |
| 28 | pCAR2-B18 | cAR2 over-expression vector | Peter Devreotes |
| 29 | pCAR3-B18 | cAR3 over-expression vector | Peter Devreotes |
| 73 | pCAR3-KO-ura | Not sure whether it is the 5cAR3ura vector described in Johnson et al. (1993) (d4673) | Peter Devreotes |
| 1075 | pCdl1a-KO | Construct used for knockout of DDB_G0286351 (cdl1a);Inserts cloned into pLPBLP with KpnI/HindIII (5' insert) and BamHI/NotI (3' insert);parent vector: pLPBLP;insert lengths: 1.016 kb (5') + 1.058 kb (3');total vector length: 6.556 kb | Gillian Forbes (Schaap Lab) |
| 1076 | pCdl1b-KO | Construct used for knockout of DDB_G0270306 (cdl1b);Inserts cloned into pLPBLP with KpnI/HindIII (5' insert) and BamHI/NotI (3' insert);parent vector: pLPBLP;insert lengths: 940 bp (5') + 937 bp (3');total vector length: 6.359 kb | Gillian Forbes (Schaap Lab) |
| 926 | pCepK-REMI | CepK REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr6:2993532 | Christopher Quang Dung Dinh/Adam Kuspa |
| 34 | pCFC5 | Expression vector containing N-terminal epitope tag (T7 antigen); Vector contains Act6P-G418R-Act8T casette; Plasmid from Chen and Katz. | Gene Katz |
| 35 | pCFC6 | Expression vector containing N-terminal epitope tag (T7 antigen); Vector contains Act6P-G418R-Act8T casette; Plasmid from Chen and Katz. | Jakob Franke |
| 588 | pchtC | Inserted PCR fragment containing regions from the chtC gene (around the insertion site) from pLAS5 (using SP6 and T7 primers) into the ClaI site of the pLPBLP plasmid. Parental strain: pLPBLP (pBluescript II KS+ backbone) | Anupama Khare (Gad Shaulsky's lab) |
| 949 | pCinC-REMI | CinC REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:692345 | Christopher Quang Dung Dinh/Adam Kuspa |
| 17 | pCnxA-GFP(S65T) | calnexin-S65T-GFP in pDEXRH (G418); S65T GFP was fused to the C‐terminus of calnexin with a spacer (RSSSKLK) in between | Annette Muller-Taubenberger |
| 880 | pCofD-1-REMI | cofD-1 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:2311735 | Christopher Quang Dung Dinh/Adam Kuspa |
| 948 | pComF-1-REMI | ComF-1 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:2776552 | Christopher Quang Dung Dinh/Adam Kuspa |
| 583 | pCotB/GFP(S65T) | GFP(S65T) expressed under the control of the cotB promoter | Danny Fuller (Loomis) |
| 352 | pCotB/LacZ | Reporter construct expressing β-galactosidase under control of the prespore cotB promoter | Bill Loomis |
| 1001 | pCotC-mRFPmars-Hyg | Expression vector for cotC-mRFPmars protein fusion under the cotC promoter; parental vector: pExp4-Hyg; insert length: 2.9kb; total vector length: 8.3kb | Yoko Yamada (Pauline Schaap) |
| 1004 | pCotCp-Df-spaA-YFP | Overexpression vector of D. fasciculatum spaA under the D. discoideum cotC promoter; parental vector: pDd-gal17 backbone; insert length: 3.1kb; total vector length: 8.6kb; gene: DFA_08790; note: recombination seems to occur frequently | Yoko Yamada (Pauline Schaap) |
| 24 | pCP33 | Extrachromosomal vector with neo cassette. Based on p155d1, with multiple cloning site added. | Peter Devreotes |
| 227 | pCP43 | ACA (adenylyl cyclase) expression vector: ACA cDNA with act15 promoter cloned into ApaI/BstXI sites of pCP43. The ACA cDNA came with its own terminator (800-bp 3'-untranslated region) | Carole Parent |
| 1090 | pCpnA-GFP | parent plasmid: pTX-GFP vector (11.2 kb), cpnA cDNA (1.8kb); cpnA cDNA is cloned into the KpnI site of pTX-GFP; the KpnI site of the pTX-GFP plasmid for expression of copines with a GFP tag at the C-terminus. | Amber Ide (Cynthia Damer) |
| 1092 | pCpnC-GFP | parent plasmid: pTX-GFP vector (11.2 kb), cpnC cDNA (1.6 kb); cpnC cDNA is cloned into the KpnI site of pTX-GFP; the KpnI site of the pTX-GFP plasmid for expression of copines with a GFP tag at the C-terminus. | Amber Ide (Cynthia Damer) |
| 1086 | pCreCpnAKO | 5? flanking cpnA gene sequence (.9 kb), 3? cpnA flanking sequence (1.5 kb); pLPBLP (4.45 kb); The DNA cpnA knockout construct was made by PCR subcloning of the 5? and 3? flanking sequences of cpnA on either side of the bsr gene into the pBSIIbsr plasmid. A 900-bp fragment upstream of the cpnA gene was PCR amplified from genomic DNA by use of the following primers: 5?-AAAATTTTAACTTCTTCATCATCATCATCT-3? and 5?-GTGAC CAAAATAACCTT-3?. A 1,500-bp fragment downstream of the cpnA gene was PCR amplified from genomic DNA by using the following primers: 5?-GG TGTATCAAATGTATCATTAG-3? and 5?-CAAATGGTGGAAGGGCTTACC-3?; | Amber Ide (Cynthia Damer) |
| 1088 | pCreCpnCKO | "cpnC 5' flanking sequence insert (987 bases); cpnC 3' flanking sequence (987 bases); pLPBLP (4.45 kb); Primers were used to amplify 5' and 3 flanking cpnC gene flanking sequences from NC4A2 genomic DNA. CpnC KO 5' forward: GGT ACC TGT GGT GAT TCT TGT GCA GT CpnC KO 5' reverse: AAG CTT TTG GAA ACC TCC TGG ACC TCT CpnC KO 3' Forward: GTG GTC CAA CTA ATT TTG CAT CAG CpnC KO 3' Reverse: TCG AAT TAC GTC CTG ATG GTG The 986 bp 5' flanking sequence was cloned into the KpnI and HindIII sites of the pLP BLP plasmid. The 987 bp 3' flanking sequence bp flanking sequence was cloned into the BamHI and NotI sites of the pL BLP plasmid." | Amber Ide (Cynthia Damer) |
| 232 | pCT7 | dmtA promoter driving gfp | Rob Kay |
| 23 | pCV5 | CV5 is derived from p88 by the addition of an actin 15 expression cassette from pMC34. | Peter Devreotes |
| 270 | pD19-lacZ | LacZ (β-galactosidase) expression under control of the prespore promoter D19 (Psa or pspA). | Adrian Harwood |
| 951 | pD7-REMI | D7 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:2276275 | Christopher Quang Dung Dinh/Adam Kuspa |
| 622 | pDBsr2a-6xMyc-TAP | Wolfgang Nellen | |
| 621 | pDBsr2a-cTAP | Wolfgang Nellen | |
| 620 | pDBsr2a-nTAP | Wolfgang Nellen | |
| 623 | pDBsr2a-TAP-6xMyc | Wolfgang Nellen | |
| 626 | pDBsrXP-3xHA | Wolfgang Nellen | |
| 627 | pDBsrXP-6xMyc | Wolfgang Nellen | |
| 629 | pDBsrXP-GFP | Wolfgang Nellen | |
| 630 | pDBsrXP-mRFPmars | Wolfgang Nellen | |
| 605 | pDchtC | Knockout vector to delete almost the entire chtC gene. Linearize with BamHI and use for homologous recombination. Used to create CCR2 / DBS0307850. | Anupama Khare (Gad Shaulsky) |
| 1042 | pDd17-gal | plasmid resistance marker (dicty): neomycin | Hajara Lawal (Pauline Schaap) |
| 1034 | pDd17-gal-DDB_G0271196 | DDB_G0271196 promoter driven by LacZ; plasmid resistance marker (dicty): neomycin; insert length: 1.3kb; parental vector: pDd17-gal | Hajara Lawal (Pauline Schaap) |
| 1036 | pDd17-gal-DDB_G0274663 | DDB_G0274663 promoter driven by LacZ; plasmid resistance marker (dicty): neomycin; insert length: 1.4kb; parental vector: pDd17-gal | Hajara Lawal (Pauline Schaap) |
| 1035 | pDd17-gal-DDB_G0275687 | DDB_G0275687 promoter driven by LacZ; plasmid resistance marker (dicty): neomycin; insert length: 1kb; parental vector: pDd17-gal | Hajara Lawal (Pauline Schaap) |
| 1037 | pDd17-gal-DDB_G0276063 | DDB_G0276063 promoter driven by LacZ; plasmid resistance marker (dicty): neomycin; insert length: 1kb; parental vector: pDd17-gal | Hajara Lawal (Pauline Schaap) |
| 1033 | pDd17-gal-DDB_G0277757 | DDB_ G0277757 promoter driven by LacZ; plasmid resistance marker (dicty): neomycin; insert length: 1.1kb; parental vector: pDd17-gal | Hajara Lawal (Pauline Schaap) |
| 1038 | pDd17-gal-DDB_G0278537 | DDB_G0278537 promoter driven by LacZ; plasmid resistance marker (dicty): neomycin; insert length: 1kb; parental vector: pDd17-gal | Hajara Lawal (Pauline Schaap) |
| 1039 | pDd17-gal-DDB_G0282455 | DDB_G0282455 promoter driven by LacZ; plasmid resistance marker (dicty): neomycin; insert length: 1.2kb; parental vector: pDd17-gal | Hajara Lawal (Pauline Schaap) |
| 1040 | pDd17-gal-DDB_G0292810 | DDB_G0292810 promoter driven by LacZ; plasmid resistance marker (dicty): neomycin; insert length: 2.0kb; parental vector: pDd17-gal | Hajara Lawal (Pauline Schaap) |
| 1032 | pDd17-gal-DDB_G0293854 | DDB G0293854 promoter driven by LacZ; parental vector: pDd17-gal; insert length: 1.1kb; plasmid resistance marker (dicty): neomycin | Hajara Lawal (PaulineSchaap) |
| 1041 | pDd17-gal-PPL_04427 | PPL_04427 promoter driven by LacZ; plasmid resistance marker (dicty): neomycin; insert length: 4.5kb; parental vector: pDd17-gal | Hajara Lawal (Pauline Schaap) |
| 185 | pDd31P4 Neo | spiA promoter in pDdGal16 | Del Richardson (via Stefan Pukatzki) |
| 39 | pDd56 | EcmB (ST310) cDNA clone isolated as a prestalk-enriched, DIF-inducible mRNA (2.4-kb cDNA cloned in the PstI site of pUC8). DDB0216219 | Jeff Williams |
| 40 | pDd63 | EcmA (ST430) cDNA clone isolated as a prestalk-enriched, DIF-inducible mRNA (2.3-kb cDNA cloned in the PstI site of pUC8); DDB0220137 | Jeff Williams |
| 739 | pDDB_G0267380-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 852 | pDDB_G0267458-REMI | DDB_G0267458 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:202526 | Christopher Quang Dung Dinh/Adam Kuspa |
| 934 | pDDB_G0267496-REMI | DDB_G0267496 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:224651 | Christopher Quang Dung Dinh/Adam Kuspa |
| 930 | pDDB_G0267496-REMI | DDB_G0267496 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:224544 | Christopher Quang Dung Dinh/Adam Kuspa |
| 724 | pDDB_G0267692-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 851 | pDDB_G0267848-REMI | DDB_G0267848 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:965278 | Christopher Quang Dung Dinh/Adam Kuspa |
| 741 | pDDB_G0267938-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 678 | pDDB_G0268222-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 957 | pDDB_G0268524_RTE-REMI | DDB_G0268524_RTE REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:843294 | Christopher Quang Dung Dinh/Adam Kuspa |
| 885 | pDDB_G0268570-REMI | DDB_G0268570 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:1492160 | Christopher Quang Dung Dinh/Adam Kuspa |
| 854 | pDDB_G0268806_ps-REMI | DDB_G0268806_ps REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:2140882 | Christopher Quang Dung Dinh/Adam Kuspa |
| 931 | pDDB_G0268872-REMI | DDB_G0268872 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:2294457 | Christopher Quang Dung Dinh/Adam Kuspa |
| 640 | pDDB_G0268888-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 912 | pDDB_G0269128-REMI | DDB_G0269128 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:3056833 | Christopher Quang Dung Dinh/Adam Kuspa |
| 694 | pDDB_G0269150-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 744 | pDDB_G0269288-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 690 | pDDB_G0269306-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 641 | pDDB_G0269760-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 956 | pDDB_G0269796_ps-REMI | DDB_G0269796_ps REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:3589319 | Christopher Quang Dung Dinh/Adam Kuspa |
| 688 | pDDB_G0269834-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 1065 | pDDB_G0269904/lacZ | The construct was made by sub-cloning the DDB_G0269904 promoter as a 1720 bp XbaI/BamHI fragment into XbaI/BglII restricted pDdGal-17; The sequence contains a BglII internal restriction site; The BglII site from the parental vector is lost; The fragment consists of the region -1555 to +160 bp from theDDB_G0269904 start and restriction sites; The construct drives the expression of β-gal when activated; Parental vector: pDdGal-17; Insert length: 1720 bp; Total vector length: 10202 bp; dictyBase gene: staG(DDB_G0269904); Bacteria used: E. coli (XL1-Blue); | Gillian Forbes (Schaap Lab) |
| 856 | pDDB_G0270048-REMI | DDB_G0270048 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:4104356 | Christopher Quang Dung Dinh/Adam Kuspa |
| 914 | pDDB_G0270342-REMI | DDB_G0270342 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:4673160 | Christopher Quang Dung Dinh/Adam Kuspa |
| 917 | pDDB_G0270344-REMI | DDB_G0270344 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:4674265 | Christopher Quang Dung Dinh/Adam Kuspa |
| 746 | pDDB_G0270470-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 697 | pDDB_G0270586-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 743 | pDDB_G0270652-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 900 | pDDB_G0270652-REMI | DDB_G0270652?REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:3648172 | Christopher Quang Dung Dinh/Adam Kuspa |
| 848 | pDDB_G0270662-REMI | DDB_G0270662 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:3696352 | Christopher Quang Dung Dinh/Adam Kuspa |
| 687 | pDDB_G0270666-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 747 | pDDB_G0270724-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 642 | pDDB_G0270786-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 872 | pDDB_G0271248-REMI | DDB_G0271248 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:227717 | Christopher Quang Dung Dinh/Adam Kuspa |
| 1062 | pDDB_G0271780/lacZ | The construct was made by sub-cloning the DDB_G0271780 promoter as a 1086 bp NheI/BglII fragment into XbaI/BglII restricted pDdGal-17; The sequence contains a XbaI internal restriction site; The XbaI site from the parental vector is lost; The fragment consists of the region -1072 to +9 bp from theDDB_G0271780 start and restriction sites; The construct drives the expression of β-gal when activated; Parental vector: pDdGal-17; Insert length: 1086 bp; Total vector length: 9568 bp; dictyBase gene: beiF(DDB_G0271780); Bacteria used: E. coli (XL1-Blue); | Gillian Forbes (Schaap Lab) |
| 699 | pDDB_G0271808-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 935 | pDDB_G0271900-REMI | DDB_G0271900 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:1045307 | Christopher Quang Dung Dinh/Adam Kuspa |
| 908 | pDDB_G0271962-REMI | DDB_G0271962 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:1081690 | Christopher Quang Dung Dinh/Adam Kuspa |
| 959 | pDDB_G0272016-REMI | DDB_G0272016 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:1175185 | Christopher Quang Dung Dinh/Adam Kuspa |
| 860 | pDDB_G0272184-REMI | DDB_G0272184 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:1513811 | Christopher Quang Dung Dinh/Adam Kuspa |
| 706 | pDDB_G0272670-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 643 | pDDB_G0272885-DDB_G0274011-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 875 | pDDB_G0272953-REMI | DDB_G0272953 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:1905849 | Christopher Quang Dung Dinh/Adam Kuspa |
| 705 | pDDB_G0272965-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 701 | pDDB_G0273017-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 869 | pDDB_G0273053-REMI | DDB_G0273053 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:2288489 | Christopher Quang Dung Dinh/Adam Kuspa |
| 742 | pDDB_G0273059-DDB_G0273737-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 644 | pDDB_G0273131-DDB_G0273639-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 938 | pDDB_G0273285-REMI | DDB_G0273285 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:2617104 | Christopher Quang Dung Dinh/Adam Kuspa |
| 712 | pDDB_G0273315-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 894 | pDDB_G0273405_ps-REMI | DDB_G0273405_ps REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:2913342 | Christopher Quang Dung Dinh/Adam Kuspa |
| 703 | pDDB_G0274267-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 645 | pDDB_G0274689-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 710 | pDDB_G0275241-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 646 | pDDB_G0275467-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 881 | pDDB_G0275671-REMI | DDB_G0275671 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:5687400 | Christopher Quang Dung Dinh/Adam Kuspa |
| 708 | pDDB_G0275745-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 863 | pDDB_G0275747-REMI | DDB_G0275747 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:5873088 | Christopher Quang Dung Dinh/Adam Kuspa |
| 722 | pDDB_G0276269-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 941 | pDDB_G0276551-REMI | DDB_G0276551 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:6874177 | Christopher Quang Dung Dinh/Adam Kuspa |
| 1066 | pDDB_G0276687/lacZ | The construct was made by sub-cloning the DDB_G0276687 promoter as a 905 bp XbaI/BglII fragment into XbaI/BglII restricted pDdGal-17;This fragment consists of the region -892 to +9 bp from theDDB_G0276687 start and restriction sites; The construct drives the expression of β-gal when activated; Parental vector: pDdGal-17; Insert length: 905kb; Total vector length: 9387kb; Bacteria used: E. coli (XL1-Blue); dictyBase gene: beiE (DDB_G0276687); | Gillian Forbes (Schaap Lab) |
| 647 | pDDB_G0277103-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 700 | pDDB_G0277245-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 958 | pDDB_G0277355-REMI | DDB_G0277355 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:7839407 | Christopher Quang Dung Dinh/Adam Kuspa |
| 918 | pDDB_G0277419-REMI | DDB_G0277419 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:8054361 | Christopher Quang Dung Dinh/Adam Kuspa |
| 704 | pDDB_G0277431-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 728 | pDDB_G0277487-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 648 | pDDB_G0277545-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 883 | pDDB_G0277661-REMI | DDB_G0277661 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:8258855 | Christopher Quang Dung Dinh/Adam Kuspa |
| 692 | pDDB_G0277951-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 921 | pDDB_G0278087_ps-REMI | DDB_G0278087_ps REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:256277 | Christopher Quang Dung Dinh/Adam Kuspa |
| 676 | pDDB_G0278171-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 732 | pDDB_G0278235-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 857 | pDDB_G0278333-REMI | DDB_G0278333 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:715753 | Christopher Quang Dung Dinh/Adam Kuspa |
| 684 | pDDB_G0278353-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 715 | pDDB_G0278457-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 668 | pDDB_G0278663-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC; Clone 1 of 2 | Christopher Quang Dung Dinh/Adam Kuspa |
| 669 | pDDB_G0278663-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC; Clone 2 of 2 | Christopher Quang Dung Dinh/Adam Kuspa |
| 903 | pDDB_G0278761-REMI | DDB_G0278761 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:1133648 | Christopher Quang Dung Dinh/Adam Kuspa |
| 749 | pDDB_G0278945-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 685 | pDDB_G0279135-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 727 | pDDB_G0279355-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 1064 | pDDB_G0279361/lacZ | The construct was made by sub-cloning the DDB_G0279361 promoter as a 1082 bp XbaI/BglII fragment into XbaI/BglII restricted pDdGal-17; This fragment consists of the region -980to +96bp from theDDB_G0279361 start and restriction sites; Thisincludes the full intergenic region before DDB_G0279361; The construct drives the expression of β-gal when activated; Parental vector: pDdGal-17; Insert length: 1082 bp; Total vector length: 9564 bp; dictyBase gene: staf(DDB_G0279361); Bacteria used: E. coli (XL1-Blue); | Gillian Forbes (Schaap Lab) |
| 867 | pDDB_G0279727-REMI | DDB_G0279727 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:2394355 | Christopher Quang Dung Dinh/Adam Kuspa |
| 693 | pDDB_G0279783-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 892 | pDDB_G0280005_ps-REMI | DDB_G0280005_ps REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:2861553 | Christopher Quang Dung Dinh/Adam Kuspa |
| 919 | pDDB_G0280029_ps-REMI | DDB_G0280029_ps REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:2854484 | Christopher Quang Dung Dinh/Adam Kuspa |
| 1063 | pDDB_G0280217/lacZ | The construct was made by sub-cloning the DDB_G0280217promoter as a 1279 bp XbaI/BglII fragment into XbaI/BglII restricted pDdGal-17; This fragment consists of the region -1271 to +3 bp from theDDB_G0280217start and restriction sites; The construct drives the expression of β-gal when activated; Parental vector: pDdGal-17; Insert length: 1279 bp; Total vector length: 9761 bp; dictyBase gene: DDB_G0280217; bacteria used: E. coli (XL1-Blue); | Gillian Forbes (Schaap Lab) |
| 649 | pDDB_G0280375-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 850 | pDDB_G0280503-REMI | DDB_G0280503 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:3455385 | Christopher Quang Dung Dinh/Adam Kuspa |
| 891 | pDDB_G0280583-REMI | DDB_G0280583 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:3528613 | Christopher Quang Dung Dinh/Adam Kuspa |
| 910 | pDDB_G0280811-REMI | DDB_G0280811 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:3753133 | Christopher Quang Dung Dinh/Adam Kuspa |
| 713 | pDDB_G0280943-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 650 | pDDB_G0281057-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 871 | pDDB_G0281349_ps-REMI | DDB_G0281349_ps REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:4382554 | Christopher Quang Dung Dinh/Adam Kuspa |
| 896 | pDDB_G0281767-REMI | DDB_G0281767 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:4932161 | Christopher Quang Dung Dinh/Adam Kuspa |
| 651 | pDDB_G0281769-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 652 | pDDB_G0281975-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 686 | pDDB_G0282113-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 672 | pDDB_G0282113-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 866 | pDDB_G0282463-REMI | DDB_G0282463 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:5793047 | Christopher Quang Dung Dinh/Adam Kuspa |
| 653 | pDDB_G0282491-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 911 | pDDB_G0283199-REMI | DDB_G0283199 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:409813 | Christopher Quang Dung Dinh/Adam Kuspa |
| 927 | pDDB_G0283215-REMI | DDB_G0283215 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:313016 | Christopher Quang Dung Dinh/Adam Kuspa |
| 847 | pDDB_G0283373-REMI | DDB_G0283373 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:556693 | Christopher Quang Dung Dinh/Adam Kuspa |
| 698 | pDDB_G0283535-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 680 | pDDB_G0284159-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 960 | pDDB_G0284625-REMI | DDB_G0284625 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:2258425 | Christopher Quang Dung Dinh/Adam Kuspa |
| 711 | pDDB_G0284847-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 890 | pDDB_G0284899-REMI | DDB_G0284899 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:2616787 | Christopher Quang Dung Dinh/Adam Kuspa |
| 1060 | pDDB_G0285289/lacZ | The construct was made by sub-cloning the DDB_G0285289 promoter as a 869 bp XbaI/BamHIfragment into XbaI/BglIIrestricted pDdGal-17; The sequence contains a BglII internal restriction site; The BglII site from the parental vector is lost; The fragment consists of the region -851to +12bp from theDDB_G0285289 start and restriction sites; The construct drives the expression of β-gal when activated; Parental vector: pDdGal-17; Insert length: 869 bp; Total vector length: 9351; dictyBase gene: spoB(DDB_G0285289); Bacteria used: E. coli (XL1-Blue); | Gillian Forbes (Schaap Lab) |
| 925 | pDDB_G0285499-REMI | DDB_G0285499 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:3316116 | Christopher Quang Dung Dinh/Adam Kuspa |
| 865 | pDDB_G0285605-REMI | DDB_G0285605 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:3453642 | Christopher Quang Dung Dinh/Adam Kuspa |
| 895 | pDDB_G0285609-REMI | DDB_G0285609 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:3456678 | Christopher Quang Dung Dinh/Adam Kuspa |
| 725 | pDDB_G0285747-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 748 | pDDB_G0285747-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 677 | pDDB_G0285859-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 736 | pDDB_G0285859-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 729 | pDDB_G0286031-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 955 | pDDB_G0286177_ps-REMI | DDB_G0286177_ps REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:4150379 | Christopher Quang Dung Dinh/Adam Kuspa |
| 695 | pDDB_G0286363-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 897 | pDDB_G0286827_ps-REMI | DDB_G0286827_ps REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:4953276 | Christopher Quang Dung Dinh/Adam Kuspa |
| 654 | pDDB_G0286967-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 932 | pDDB_G0287083-REMI | DDB_G0287083 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:5307403 | Christopher Quang Dung Dinh/Adam Kuspa |
| 1061 | pDDB_G0287091/lacZ | The construct was made by sub-cloning the DDB_G0287091 promoter as a 730 bp XbaI/BamHI fragment into XbaI/BglII restricted pDdGal-17; The sequence contains a BglII internal restriction site; The BglII site from the parental vector is lost; The fragment consists of the region -718 to +6 bp from theDDB_G0287091 start and restriction sites; The construct drives the expression of β-gal when activated; Parental vector: pDdGal-17; Insert length: 730 bp; Total vector length: 9212; dictyBase gene: staE(DDB_G0287091); Bacteria used: E. coli (XL1-Blue); | Gillian Forbes (Schaap Lab) |
| 901 | pDDB_G0287167-REMI | DDB_G0287167 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:5424509 | Christopher Quang Dung Dinh/Adam Kuspa |
| 689 | pDDB_G0287421_RTE-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 691 | pDDB_G0287515-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 696 | pDDB_G0287659-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 874 | pDDB_G0287825-REMI | DDB_G0287825 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:772632 | Christopher Quang Dung Dinh/Adam Kuspa |
| 899 | pDDB_G0287873-REMI | DDB_G0287873 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:626176 | Christopher Quang Dung Dinh/Adam Kuspa |
| 936 | pDDB_G0287873-REMI | DDB_G0287873REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:625903 | Christopher Quang Dung Dinh/Adam Kuspa |
| 730 | pDDB_G0287877-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 655 | pDDB_G0287895/DDB_G0287897-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 946 | pDDB_G0287931-REMI | DDB_G0287931 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:863802 | Christopher Quang Dung Dinh/Adam Kuspa |
| 731 | pDDB_G0288007-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 657 | pDDB_G0288419-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 656 | pDDB_G0288419-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 1058 | pDDB_G0288489/lacZ | The construct was made by sub-cloning the DDB_G0288489promoter as a 776 bp XbaI/BglII fragment into XbaI/BglII restricted pDdGal-17; This fragment consists of the region -743to +27bp from theDDB_G0288489start and restriction sites; The construct drives the expression of β-gal when activated; Parental vector: pDdGal-17; Insert length: 776 bp; Total vector length: 9258 bp; dictyBase gene: spoA(DDB_G0288489); Bacteria based used: E. coli (XL1-Blue); | Gillian Forbes (Schaap Lab) |
| 846 | pDDB_G0288519-REMI | DDB_G0288519 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:1635820 | Christopher Quang Dung Dinh/Adam Kuspa |
| 942 | pDDB_G0288987-REMI | DDB_G0288987 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:2207637 | Christopher Quang Dung Dinh/Adam Kuspa |
| 709 | pDDB_G0289231-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 876 | pDDB_G0289363-REMI | DDB_G0289363 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:2707405 | Christopher Quang Dung Dinh/Adam Kuspa |
| 733 | pDDB_G0289503-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 953 | pDDB_G0289517-REMI | DDB_G0289517 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:2902373 | Christopher Quang Dung Dinh/Adam Kuspa |
| 716 | pDDB_G0289791-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 658 | pDDB_G0289805-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 940 | pDDB_G0289903-REMI | DDB_G0289903 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:3386664 | Christopher Quang Dung Dinh/Adam Kuspa |
| 888 | pDDB_G0290061-REMI | DDB_G0290061 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:3592963 | Christopher Quang Dung Dinh/Adam Kuspa |
| 726 | pDDB_G0290347-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 734 | pDDB_G0290481-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 702 | pDDB_G0290535-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 898 | pDDB_G0290697-REMI | DDB_G0290697 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:4432136 | Christopher Quang Dung Dinh/Adam Kuspa |
| 878 | pDDB_G0290835-REMI | DDB_G0290835 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:4620721 | Christopher Quang Dung Dinh/Adam Kuspa |
| 735 | pDDB_G0291263-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 723 | pDDB_G0291350-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 679 | pDDB_G0291464-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 877 | pDDB_G0291632-REMI | DDB_G0291632 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr6:428069 | Christopher Quang Dung Dinh/Adam Kuspa |
| 745 | pDDB_G0291800-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 717 | pDDB_G0291824-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 714 | pDDB_G0292168-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 939 | pDDB_G0292462-REMI | DDB_G0292462 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr6:1678362 | Christopher Quang Dung Dinh/Adam Kuspa |
| 853 | pDDB_G0292842_ps-REMI | DDB_G0292842_ps REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr6:2139155 | Christopher Quang Dung Dinh/Adam Kuspa |
| 944 | pDDB_G0293300-REMI | DDB_G0293300 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr6:2736118 | Christopher Quang Dung Dinh/Adam Kuspa |
| 864 | pDDB_G0293550-REMI | DDB_G0293550 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr6:3024213 | Christopher Quang Dung Dinh/Adam Kuspa |
| 924 | pDDB_G0293612-REMI | DDB_G0293612 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr6:3143542 | Christopher Quang Dung Dinh/Adam Kuspa |
| 929 | pDDB_G0293612-REMI | DDB_G0293612 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr6:3143638 | Christopher Quang Dung Dinh/Adam Kuspa |
| 681 | pDDB_G0293662-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 937 | pDDB_G0293762-REMI | DDB_G0293762 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr6:3295778 | Christopher Quang Dung Dinh/Adam Kuspa |
| 907 | pDDB_G0293856-REMI | DDB_G0293856 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr6:3390511 | Christopher Quang Dung Dinh/Adam Kuspa |
| 922 | pDDB_G0293948-REMI | pDDB_G0293948 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr6:3559965 | Christopher Quang Dung Dinh/Adam Kuspa |
| 659 | pDDB_G0293982-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 707 | pDDB_G0295493-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 738 | pDDB_G0295493-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 740 | pDDB_G0295493-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 737 | pDDB_G0295493-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 1057 | pDDB_G0295797/lacZ | The construct was made by sub-cloning the DDB_G0295797 promoter as a 817 bp XbaI/BglII fragment into XbaI/BglII restricted pDdGal-17; This fragment consists of the region -808 to +3 bp from theDDB_G0295797 start and restriction sites; The construct drives the expression of β-gal when activated; Parental vector: pDdGal-17; Insert length: 817 bp; Total vector length: 9299; dictyBase gene: expl7(DDB_G0295797); Bacteria used: E. coli (XL1-Blue); | Gillian Forbes (Schaap Lab) |
| 660 | pDDB_G0305538-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 923 | pDDB_G0349499-REMI | DDB_G0349499 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:2211482 | Christopher Quang Dung Dinh/Adam Kuspa |
| 838 | pDdCherry-mRFP | mRFP_DdCherry (in 82, HindIII-EcoRI) | Annette Muller-Taubenberger |
| 837 | pDdDendra2 | Dd Dendra2 (in 456-22 HindIII-BamHI; minus GFP) | Annette Muller-Taubenberger |
| 266 | pDdGal-15 (H+) | Galactosidase vector with HindIII site after terminator. | Adrian Harwood |
| 267 | pDdGal-16 (H-) | Galactosidase vector without HindIII site after terminator. | Adrian Harwood |
| 268 | pDdGal-17 (H+) | Galactosidase vector with HindIII site after terminator. | Adrian Harwood |
| 269 | pDdGal-17 (H-) | Galactosidase vector without HindIII site after terminator. | Adrian Harwood |
| 835 | pDdPlum | Dd Plum (in 456-22 HindIII-BamHI; minus GFP) | Annette Muller-Taubenberger |
| 217 | pDE-0.9 | Coding region of the extracellular phosphodiesterase. (0.9-kb BstBI-EcoRI fragment, from cDNA clone p-1.2, subcloned in pUC19 digested with AccI and EcoRI) | Jakob Franke |
| 119 | pDE102 | Vector containing hygromycin cassette | Tom Egelhoff |
| 187 | pDE104 | integrative vector with hygromycin selection under the control of the act15 promoter and act15 terminator; note that hygromycin selection does not works reproducibly | Tom Egelhoff |
| 120 | pDE109 | Non-autonomous extrachromosomal expression vector with hygromycin selection cassette. | Tom Egelhoff |
| 604 | pDEX-Cre-hygR | Dictyostelium Cre expression vector with a hygromycin resistance cassette. | Anupama Khare (Gad Shaulsky) |
| 1000 | pDEX-HECTC-5185-S-GFP | point mutation of the conserved Cysteine 5185 to a Serine in the HECT domain of the HECTPH1 protein (gene hephA); mutated in the pDEX-HECTwt-GFP construct, also available | Salvo Bozzaro |
| 999 | pDEX-HECTwt-GFP | fusion of the HECTPH1 protein (gene hephA) HECT domain (residues 4855-5212) to GFP at the C-terminus, in the pDEXH vector | Salvo Bozzaro |
| 8 | pDEX-NLS-cre | Dictyostelium Cre expression vector for the generation of multiple gene disruptions | Jan Faix |
| 409 | pDEXH | Expression vector based on pIC20R. Expression of inserted cDNAs is driven by an actin 15 promoter and terminated by an actin 8 tandem terminator. Bacterial Tn5 phosphotransferase under the control of the actin 6 promoter allows selection of Dictyostelium transformants with G418. Sequence note: 1-290 is actin 15 promoter; 301-394 is actin 8 terminator. | Jan Faix |
| 366 | pDEXH-GFP-PiaAHSB1 | GFP-PIA expression vector (temperature sensitive) | Salvo Bozzaro |
| 290 | pDEXH-GFP-PiaAWT | GFP-Pianissimo expression vector. piaA | Salvatore Bozzaro |
| 410 | pDEXRH | Modified version of pDEXH. Expression vector based on pIC20R. Expression of inserted cDNAs is driven by an actin 15 promoter and terminated by an actin 8 tandem terminator. Bacterial Tn5 under the control of the actin 6 promoter allows selection of Dictyostelium transformants with G418. Sequence note: 1-290 is actin 15 promoter; 311-402 is actin 8 terminator. | Jan Faix |
| 997 | pDexRH(-)NrampB(C)GFP | NrampB fused to GFP at the C-terminus cloned in the pDEXRH- vector | Salvo Bozzaro |
| 101 | pDF15 | myosin heavy chain kinase gene replacement vector containing the Thy1 gene | Tom Egelhoff |
| 859 | pDG1113 -REMI | DG1113 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:4213739 | Christopher Quang Dung Dinh/Adam Kuspa |
| 814 | pDgcA-KO | dgcA knockout vector | Zhihui Chen / Pauline Schaap |
| 473 | pDH-GFPABD120 | Vector containing a hygromycin-resistance cassette expressing a fusion of GFP and the actin-binding domain of ABD120 (filamin). Sequence note: PCR product of ABP120 ABD cloned into BglII site of pDHGFP; GFP-ABD coding: 291-1757. | David Knecht |
| 355 | pDH29 | Remi plasmid for ura selection (derived from pJB1) | Dale Hereld |
| 299 | pDimA-KO | dimA knockout construct | Chris Thompson |
| 230 | pDIV1 | pyr5-6 remi plasmid (not yet available) | |
| 228 | pDIV2 | Remi plasmid (DIV2 is the same as DIV1 shown below, except it contains the pyr5-6-containing ClaI fragment in the opposite orientation). | Bill Loomis |
| 229 | pDIV6 | Remi plasmid. The PstI-SacI pyr5-6 fragment from DIV1 was ligated into PstI/SacI digested pGEM-5Zf(+) (Promega). | Bill Loomis |
| 1010 | pDM1208 | Extrachromosomal expression vector, N-terminal expression of mCherry, G418 resistant | David Knecht / Douwe Veltman |
| 1009 | pDM1210 | Extrachromosomal expression vector, C-terminal expression of mCherry, G418 resistant | David Knecht / Douwe Veltman |
| 562 | pDM131 | Plasmid containing N-terminal mRFPmars tag. | Douwe Veltman |
| 563 | pDM193 | Plasmid containing N-terminal GST tag. | Douwe Veltman |
| 564 | pDM229 | Plasmid containing N-terminal TAP tag. | Douwe Veltman |
| 565 | pDM276 | Plasmid containing C-terminal TAP tag. | Douwe Veltman |
| 816 | pDM281 | tetOFF or doxOFF control vector expressing luciferase | Douwe Veltman / Robert Insall |
| 815 | pDM295 | tet-on control vector expressing luciferase | Douwe Veltman / Robert Insall |
| 532 | pDM304 | extrachromosomal expression vector. MCS BglII/SpeI; G418 resistance; modular expression vector | Douwe Veltman |
| 516 | pDM309 | Extrachromosomal, inducible expression vector. Transactivator tTA. MCS BglII/SpeI. G418 resistance. | Douwe Veltman |
| 517 | pDM310 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. | Douwe Veltman |
| 567 | pDM312 | Plasmid containing C-terminal mRFPmars tag. | Douwe Veltman |
| 566 | pDM313 | Plasmid containing C-terminal GFP tag. | Douwe Veltman |
| 537 | pDM314 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. N-terminal GST tag. | Douwe Veltman |
| 539 | pDM315 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. N-terminal TAP tag. | Douwe Veltman |
| 535 | pDM317 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. N-terminal GFP tag. - Douwe Veltman will send a new version of the plasmid (April 2009) | Douwe Veltman |
| 536 | pDM318 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. N-terminal mRFPmars tag. | Douwe Veltman |
| 538 | pDM320 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. N-terminal FLAG tag. | Douwe Veltman |
| 542 | pDM321 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. C-terminal TAP tag. | Douwe Veltman |
| 540 | pDM323 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. C-terminal GFP tag. | Douwe Veltman |
| 541 | pDM324 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. C-terminal mRFPmars tag. | Douwe Veltman |
| 533 | pDM326 | Extrachromosomal expression vector. MCS BglII/SpeI. Blasticidin resistance. | Douwe Veltman |
| 552 | pDM327 | NgoMIV shuttle vector. MCS BglII/SpeI. N-terminal GFP tag. | Douwe Veltman |
| 553 | pDM328 | NgoMIV shuttle vector. MCS BglII/SpeI. N-terminal mRFPmars tag. | Douwe Veltman |
| 555 | pDM329 | NgoMIV shuttle vector. MCS BglII/SpeI. C-terminal GFP tag. | Douwe Veltman |
| 554 | pDM330 | NgoMIV shuttle vector. MCS BglII/SpeI. C-terminal mRFPmars tag. | Douwe Veltman |
| 520 | pDM331 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. N-terminal GST tag. | Douwe Veltman |
| 521 | pDM332 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. N-terminal TAP tag. | Douwe Veltman |
| 522 | pDM334 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. N-terminal GFP tag. | Douwe Veltman |
| 523 | pDM335 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. N-terminal mRFPmars tag. | Douwe Veltman |
| 524 | pDM338 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. C-terminal TAP tag. | Douwe Veltman |
| 525 | pDM340 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. C-terminal GFP tag. | Douwe Veltman |
| 526 | pDM341 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. C-terminal mRFPmars tag. | Douwe Veltman |
| 551 | pDM344 | NgoMIV shuttle vector. MCS BglII/SpeI. | Douwe Veltman |
| 568 | pDM347 | Plasmid containing Gateway conversion cassette. | Douwe Veltman |
| 543 | pDM351 | Extrachromosomal expression vector. Gateway. G418 resistance. N-terminal GFP tag. | Douwe Veltman |
| 544 | pDM352 | Extrachromosomal expression vector. Gateway. G418 resistance. N-terminal mRFPmars tag. | Douwe Veltman |
| 546 | pDM353 | Extrachromosomal expression vector. Gateway. G418 resistance. C-terminal GFP tag. | Douwe Veltman |
| 545 | pDM354 | Extrachromosomal expression vector. Gateway. G418 resistance. C-terminal mRFPmars tag. | Douwe Veltman |
| 534 | pDM358 | Extrachromosomal expression vector. MCS BglII/SpeI. Hygromycin resistance. | Douwe Veltman |
| 518 | pDM359 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. Hygromycin resistance. | Douwe Veltman |
| 979 | pDM359/KrsB-GFP | Used for doxycycline-inducible expression of KrsB; KrsB-GFP amplified from krsB-GFP/pKF3 9with BamHI & XbaI sites on primer ends) and cloned into BgIII/SpeI sites of pDM359 (sites were destroyed); total vector length: 13.1 kb; insert length: 4.4 kb; parental vector: pDM359 | Yulia Artemenko (Devreotes Lab) |
| 519 | pDM360 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. Blasticidin resistance. | Douwe Veltman |
| 828 | pDM368 | PCR ligation vector, kanamycin resistant; must be propagated in E. coli DB3.1, see ref for more details. | Douwe Veltman / Robert Insall |
| 527 | pDM369 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. Hygromycin resistance. N-terminal GFP tag. | Douwe Veltman |
| 528 | pDM370 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. Hygromycin resistance. C-terminal GFP tag. | Douwe Veltman |
| 529 | pDM371 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. Gateway. Hygromycin resistance. N-terminal GFP tag. | Douwe Veltman |
| 530 | pDM372 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. Gateway. Hygromycin resistance. C-terminal GFP tag. | Douwe Veltman |
| 531 | pDM373 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. Gateway. Hygromycin resistance. | Douwe Veltman |
| 556 | pDM410 | NgoMIV shuttle vector. Gateway. N-terminal GFP tag. | Douwe Veltman |
| 557 | pDM411 | NgoMIV shuttle vector. Gateway. N-terminal mRFPmars tag. | Douwe Veltman |
| 559 | pDM412 | NgoMIV shuttle vector. Gateway. C-terminal GFP tag. | Douwe Veltman |
| 558 | pDM413 | NgoMIV shuttle vector. Gateway. C-terminal mRFPmars tag. | Douwe Veltman |
| 560 | pDM414 | NgoMIV shuttle vector. Gateway. | Douwe Veltman |
| 547 | pDM448 | Extrachromosomal modular expression vector. Gateway. Hygromycin resistance. N-terminal GFP tag. | Douwe Veltman |
| 548 | pDM449 | Extrachromosomal modular expression vector. Gateway. Hygromycin resistance. N-terminal mRFPmars tag. | Douwe Veltman |
| 550 | pDM450 | Extrachromosomal modular expression vector. Gateway. Hygromycin resistance. C-terminal GFP tag. | Douwe Veltman |
| 549 | pDM451 | Extrachromosomal modular expression vector. Gateway. Hygromycin resistance. C-terminal mRFPmars tag. | Douwe Veltman |
| 1031 | pDMBsr | Displace g418 resistance into blasticidin s resistance in pDM314; the act15 promoter is on BamHI side; dicty resistance: blasticidin; parental vector: pDM314 | Gong Chen (Gad Shaulsky) |
| 1030 | pDMBsr-tgrB1::ssmycTgrB1ex(AX4) | expression myc-tagged tgrB1(AX4) whole protein; plasmid resistance marker (Dicty): blasticidin; parental vector: pDMBSr; insert length: 2.8kb | Gong Chen (Gad Shaulsky) |
| 986 | pDM_lITR_BglII/SpeI_rITR | Vector can be used for bidirectional expression of a target sequence which leads to the generation of siRNAs to knockdown the corresponding target gene (see also Friedrich et al., 2015). Since the knock-down plasmid contains inverted repeats cloning may lead to deletions or rearrangements of the vector, cloning in E.coli Sure cells avoids this problem. Parental Vector: pDM304 (Veltman, 2009); Total Vector Length: 6933 bp. | Michael Friedrich (Nellen Lab) |
| 103 | pDNeo2 | Expression vector including the start codon and first 8 amino acids of actin 6; Sequence note: This sequence has been provided by Piero Morandini and Klaus Salger. | A. Noegel? |
| 113 | pDNeo2-Dd-TRAP1 | Dd-TRAP1 overexpression vector | Yasuo Maeda |
| 612 | pDneo2a | Expression vector created by modifying the commonly used pDneo2 vector, removing the first 8 amino acids and start codon of the actin 6 gene. | Wolfgang Nellen |
| 624 | pDneo2a-3xFLAG | Wolfgang Nellen | |
| 615 | pDneo2a-3xHA | Wolfgang Nellen | |
| 617 | pDneo2a-3xHA-TAP | Wolfgang Nellen | |
| 600 | pDneo2a-6xMYC | ||
| 614 | pDneo2a-6xMyc | Wolfgang Nellen | |
| 618 | pDneo2a-6xMyc-TAP | Wolfgang Nellen | |
| 616 | pDneo2a-cTAP | Wolfgang Nellen | |
| 613 | pDneo2a-GFP | expression vector for GFP under the control of the actin 6 promoter; parental vector is pDneo2a that has the first amino acids and start codon of act6 removed; neomycin resistance | Wolfgang Nellen |
| 619 | pDneo2a-GFP-TAP | Wolfgang Nellen | |
| 625 | pDneo2a-mRFP | Wolfgang Nellen | |
| 608 | pDneo2a-nTAP | Wolfgang Nellen | |
| 610 | pDneo2a-TAP-3xHA | Wolfgang Nellen | |
| 609 | pDneo2a-TAP-6xMyc | Wolfgang Nellen | |
| 611 | pDneo2a-TAP-GFP | Wolfgang Nellen | |
| 74 | pDNeo67 | Expression vector derived from pDNeoII by BAL31 digestion of the 4 methionine codons between the actin6 promoter and the mcs. The start codon has to be provided by the insert. | C. Klein? |
| 479 | pDNeo67-dia2-gfp | Vector expressing DIA2-GFP. | Aiko Amagai |
| 89 | pDng-KI | Dominant-negative knock-in construct for Gγ (Dicty Gγ without the C-terminal four amino acids). Same as GγΔ? | Peter Devreotes |
| 806 | pDox-alpha-cateninhp | RNAi construct for D. discoideum alpha-catenin (ctnnA); the hairpin is expressed under the control of a doxycycline-inducible promoter, allowing controlled knockdown of ctnnA. | Daniel Dickinson / James Nelson and Bill Weis Lab |
| 464 | pDRH:GFP-tubulin | Ddp1-based expression vector for GFP-tubulin containing a hygromycin selection cassette. | Douglas Robinson |
| 465 | pDRH:RFP-tubulin | Ddp1-based expression vector for RFP-tubulin containing a hygromycin selection cassette. | Douglas Robinson |
| 463 | pDRHyg | Ddp1-based expression vector containing a hygromycin selection cassette. | Douglas Robinson |
| 320 | pdsB KO1234 | Pauline Schaap | |
| 319 | pdsB KO5234 | Pauline Schaap | |
| 233 | pDT1 | regA KO bsr. Insert blasticidin cassette into AHindIII332pKS (pDT4) as Xba fragment, then insert 3' homology as NotI/SacII PCR products. | Rob Kay |
| 235 | pDT12 | regA driven by actin 15 | Rob Kay |
| 234 | pDT5 (iplA-KO2) | iplA knockout construct | Rob Kay |
| 301 | pDU3B1 | DdPYR5-6 gene (3.7-kb genomic DNA in pBR322) | Jakob Franke |
| 325 | pDV-CGFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a C-terminal GFP tag. | Pauline Schaap |
| 326 | pDV-CGFP-CTAP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a C-terminal GFP and C-terminal TAP | Pauline Schaap |
| 243 | pDV-CTAP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a TAP tag at the C-terminus. | Pauline Schaap |
| 313 | pDV-CYFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a YFP tag at the C-terminus. | Pauline Schaap |
| 329 | pDV-CYFP-CTAP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a C-terminal YFP and C-terminal TAP tag. | Pauline Schaap |
| 1069 | pDV-fAR1-CYFP | overexpression of fAR1 with YFP tag; parental vector: pDV-CYFP, dictyBase genes: far1 | Miao Pan (Tian Jin) |
| 1070 | pDV-fAR1-CYFP | overexpression of fAR1 with YFP tag; parental vector: pDV-CYFP, dictyBase genes: far1, plasmid resistance: amp | Miao Pan (Tian Jin) |
| 244 | pDV-NTAP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a TAP tag at the N-terminus. | Pauline Schaap |
| 333 | pDV-NTAP-CGFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and an N-terminal TAP tag and C-terminal GFP. | Pauline Schaap |
| 335 | pDV-NTAP-CYFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and an N-terminal TAP tag and C-terminal YFP | Pauline Schaap |
| 331 | pDV-NTAP-NYFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and N-terminal TAP and YFP tags. | Pauline Schaap |
| 327 | pDV-NYFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and an N-terminal YFP tag. | Pauline Schaap |
| 328 | pDV-NYFP-CTAP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and an N-terminal YFP and C-terminal TAP tag. | Pauline Schaap |
| 63 | pDXA-3C | Expression vector under control of the actin 15 promoter and carrying a C-terminal c-myc tag. | Dietmar Manstein |
| 199 | pDXA-3FLAG | Dictyostelium expression vector with an N-terminal FLAG tag. | Dietmar Manstein |
| 198 | pDXA-3H | Expression vector under control of the actin 15 promoter and carrying a C-terminal 8-histidine tag. Sequence note: sequence length is 6105 bp. | Dietmar Manstein |
| 336 | pDXA-3H-BL | pDXA-3H in which the G418-resistance cassette has been replaced with a blasticidin-resistance marker; note, this added a second Xho I restriction site into the vector, making this site unsuitable for cloning purposes. | Doug Robinson |
| 186 | pDXA-3H-Hygro | Dictyostelium expression vector derived from the vector pDXA-3H (6.1 kb), containing an hygromycin resistance cassette and a C-terminal histidine tag. | Dietmar Manstein |
| 1020 | pDXA-A15ssHis7TgrB1ex(AX4) | secretory over-expression His-tagged TgrB1(AX4)extracellular domain; plasmid resistance marker (Dicty): neoymycin; parental vector: pDXA; insert length: 2.8kb | Gong Chen (Gad Shaulsky) |
| 1022 | pDXA-A15ssHis7TgrB1ex(QS31) | secretory over-expression His-tagged TgrB1(QS31) extracellular domain; plasmid resistance marker (Dicty): neomycin; parental vector: pDXA; insert length: 2.8kb | Gong Chen (Gad Shaulsky) |
| 1023 | pDXA-A15ssHis7TgrB1ex(QS37) | secretory over-expression His-tagged tgrB1(QS37) extracellular domain; plasmid resistance marker (Dicty): neomycin; parental vector: pDXA; insert length: 2.8kb | Gong Chen (Gad Shaulsky) |
| 1021 | pDXA-A15ssHis7TgrB1ex(QS4) | secretory over-expression His-tagged tgrB1(QS4) extracellular domain; parental vector: pDXA; insert length: 2.8kb; plasmid resistance marker (Dicty): neoymycin | Gong Chen (Gad Shaulsky) |
| 1025 | pDXA-A15TgrC1ex(AX4) | secretory over-expression untagged TgrC1(AX4) extracellular domain; plasmid resistance marker (Dicty): neomycin; parental vector: pDXA; insert length: 2.8kb | Gong Chen (Gad Shaulsky) |
| 1027 | pDXA-A15TgrC1ex(QS31) | secretory over-expression untagged tgrC1(QS31) extracellular domain; plasmid resistance marker (Dicty): neomycin; parental vector: pDXA; insert length: 2.8kb | Gong Chen (Gad Shaulsky) |
| 1028 | pDXA-A15TgrC1ex(QS37) | secretory over-expression untagged tgrC1(QS37) extracellular domain; plasmid resistance marker (Dicty): neomycin; parental vector: pDXA; insert length: 2.8kb | Gong Chen (Gad Shaulsky) |
| 1026 | pDXA-A15TgrC1ex(QS4) | secretory over-expression untagged tgrC1(QS4) extracellular domain; plasmid resistance marker (Dicty): neomycin; parental vector: pDXA; insert length: 2.8kb | Gong Chen (Gad Shaulsky) |
| 1029 | pDXA-A15TgrC1ex(QS45) | secretory over-expression untagged tgrC1(QS45) extracellular domain; plasmid resistance marker (Dicty): neomycin; parental vector: pDXA; insert length: 2.8kb | Gong Chen (Gad Shaulsky) |
| 95 | pDXA-CFP-MCS | Dictyostelium expression vector with an N-terminal CFP tag. | Dietmar Manstein |
| 109 | pDXA-FLAG | Dictyostelium expression vector based on Ddp2 (extrachromosomal in the presence of pREP) | Tom Egelhoff |
| 110 | pDXA-GFP2 | Dictyostelium expression vector based on Ddp2 (extrachromosomal in the presence of pREP) | Tom Egelhoff |
| 472 | pDXA-GFPABD120 | Vector expressing a fusion protein between GFP and the actin-binding domain of ABD120 (filamin). | David Knecht |
| 203 | pDXA-GST | Dictyostelium expression vector with an N-terminal GST tag and a C-terminal histidine tag. | Dietmar Manstein |
| 31 | pDXA-HC | Expression vector under control of the actin 15 promoter and carrying an N-terminal histidine tag and a C-terminal c-myc tag. Plasmid has been resequenced. | Dietmar Manstein |
| 96 | pDXA-HY | Dictyostelium expression vector with proteins expressed from the actin 15 promoter and providing an N-terminal 7-His tag and a C-terminal YL1/2-epitope tag. | Dietmar Manstein |
| 94 | pDXA-MCS-YFP | Dictyostelium expression vector with a C-terminal YFP tag. | Dietmar Manstein |
| 263 | pDXA-VatM-GFP | VatM-GFP fusion protein expression vector | Margaret Clarke |
| 201 | pDXA-YFP-MCS | Dictyostelium expression vector with an N-terminal YFP tag. | Dietmar Manstein |
| 585 | pDXA-YFP-MCS1-PKA-Fret | cAMP-binding domain B from the mammalian PKA RII β-subunit cloned between eCFP and eYFP in a Dictyostelium expression vector; FRET probe to detect cAMP in Dicty. The map are is the parental vector pDXA-YFP-MCS, see sequence for more information. | Satarupa Das / Carole Parent Lab |
| 1024 | pDXA[act15]:His7:TgrB1/QS45 | secretory over-expression His-tagged TgrB1(QS45) extracellular domain; plasmid resistance marker (Dicty): neomycin; parental vector: pDXA; insert length: 2.8kb | Gong Chen (Gad Shaulsky) |
| 204 | pDXD-3C | Dictyostelium expression vector under control of the inducible discoidin Iγ promoter and carrying a C-terminal c-myc tag. | Dietmar Manstein |
| 205 | pDXD-3H | Dictyostelium expression vector under control of the inducible discoidin Iγ promoter and carrying a C-terminal histidine tag. | Dietmar Manstein |
| 580 | pEcm0-i-alpha-gal | ecm0 promoter driving labile gal in V18Tn5 backbone | Harry MacWilliams |
| 581 | pEcm0-i-alpha-gal & pEcm0-Ugus | ecm0 promoter driving labile gal and stable gus | Harry MacWilliams |
| 579 | pEcm0-labile-S65T-GFP | ligation of labile GFP into pst0p/V18Tn5 backbone | Harry MacWilliams |
| 46 | pEcmA-Gal | EcmA PCR'd promoter fragments inserted into BamHI site of A15deltaBam-gal. 3'end, Bam/BglII at +250 (just upstream of EcmA-ATG). 5'end, BamHI site at variable points. (prestalk marker) | Jeff Williams |
| 1083 | pEcmA-ile-gal | Promoter of ecmA (DDB_G0277853) fused to the unstable lacZ reporter ? the ile-gal construct (Detterbeck et al., 1994); Insert cloned into BamHI/BglII sites but BamHI site destroyed; Can be digested out using XbaI/BglII; insert length: ~2.3 kb insert; total vector length: 11 kb; created by: Harry MacWilliams | Gillian Forbes (Schaap Lab) |
| 277 | pEcmA-Rc | EcmA::PKA-Rsubunit (Rc mutant does bind C subunit = control) expression vector | Adrian Harwood |
| 278 | pEcmA-Rm | EcmA::PKA-Rsubunit (Rm mutant) expression vector | Adrian Harwood |
| 584 | pEcmA/GFP(S65T) | GFP(S65T) expressed under the control of the ecmA promoter | Danny Fuller (Loomis) |
| 577 | pEcmA0-i-alpha-gal | ecmA whole promoter driving iDQgal / V18Tn5 backbone | Harry MacWilliams |
| 578 | pEcmA0-i-alpha-gal & pEcmA0-Ugus | ecmA0 promoter (aka "63") driving labile gal and stable gus | Harry MacWilliams |
| 576 | pEcmA0-labile-S65T-GFP | ecmA promoter driving semilabile GFP in V18Tn5DRE | Harry MacWilliams |
| 50 | pEcmAO-Gal | Galactosidase fusion expression vector (prestalk marker) | Jeff Williams |
| 639 | pEcmAO-RFPmars | Susan Ross (Jeff Williams) | |
| 51 | pEcmB-Gal | Galactosidase fusion expression vector (prestalk marker) | Jeff Williams |
| 575 | pEcmB-i-alpha-gal | ligation of ecmBprom into iDQgal backbone | Harry MacWilliams |
| 638 | pEcmB-RFPmars | MARS-RFP fusion expression vector (pre-stalk marker) | Susan Ross (Jeff Williams) |
| 90 | pEgeA-GFP | GFP fused to the COOH-terminal of EgeA expression vector. | Peter Devreotes |
| 844 | pET28a-RegA | Plasmid used for Acas RegA expression vector in bacteria E.coli BL21DE3; Acas RegA is fused at the N-terminus to a hex-his-tag | Qingyou Du (Pauline Schaap) |
| 356 | pEXP4(+) | Integrating expression vector based on pATSP. | Karin Weening (Pauline Schaap) |
| 1059 | pExpl7/lacZ | The construct was made by sub-cloning the DDB_G0288331promoter as a 1270bp XbaI/BglII fragment into XbaI/BglII restricted pDdGal-17; This fragment consists of the region -1225to +39 bp from theDDB_G0288331start and restriction sites; This includes the full intergenic region before DDB_G0288331; The construct drives the expression of β-gal when activated; Parental vector: pDdGal-17; Insert length: 1270 bp; Total vector length: 9752 bp; dictyBase gene: expl7(DDB_G0288331); Bacteria used: E. coli (XL1-Blue); | Gillian Forbes (Schaap Lab) |
| 10 | pEZTN:tetR-bsR | Vector containing a transposable bsR cassette; total size 5.4 kb; transposon size 3 kb. | Tomo Abe |
| 105 | pFadB-KO | fadB knockout vector with the Bsr cassette inserted in the BglII site. | Tamao Saito |
| 950 | pFia-REMI | Fia REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:1932550 | Christopher Quang Dung Dinh/Adam Kuspa |
| 1077 | pFig4-KO | Construct used for knockout of DDB_G0281427 (fig4);Inserts cloned into pLPBLP with KpnI/SalI (5' insert) and PstI/SpeI (3' insert);parent vector: pLPBLP;insert lengths: 1.211 kb (5') + 1.114 kb (3');total vector length: 6.827 kb | Gillian Forbes (Schaap Lab) |
| 486 | pFL474 | apm2-knockout construct. PCR-amplified 3' and 5' regions of apm2 (mu2 or ?2), with a bsR cassette inserted in between, in pBluescript. | Francois Letourneur |
| 488 | pFL505 | Full-length apm1 (mu1 or µ1) expression construct in pDXA-3C. | Francois Letourneur |
| 484 | pFL603 | apm1-knockout construct. PCR amplified 3'- and 5'-regions of apm1 (mu1 or ?1), with bsR cassette inserted in between, in pBluescript. | Francois Letourneur |
| 489 | pFL619 | γ-Adaptin-GFP expression construct in pDXA-3C. | Francois Letourneur |
| 491 | pFL674 | CsA-Rh50 | Francois Letourneur |
| 490 | pFL712 | Full-length cDNA sequence coding for Phg2 was cloned into the pDXA-GFP2 expression vector. | Francois Letourneur |
| 242 | pflCAP-GFP | Full-length CAP cloned in frame with GFP in pDEX-T65S-GFP. | Angelika Noegel |
| 889 | pFnkE-REMI | fnkE REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:5841954 | Christopher Quang Dung Dinh/Adam Kuspa |
| 832 | pG3-C129 | Plasmid containing the full length genomic EcoR1 fragment that contains the entire AmpA gene in pGem3 at the EcoR1 site; includes about 1kb upstream and downstream of the ampA gene. | Beth Noratel / Daphne Blumberg |
| 219 | pG3Neo-AmpA | Construct used to generate Ampa overexpressors and to rescue AmpA knockouts | Daphne Blumberg |
| 231 | pG3NeoI | Expression vector in which the expression of the neomycin phosphotransferase gene (Tn903) is driven by the actin 15 promoter. | Bill Loomis |
| 80 | pGACG | Insertion of fragment from pλ22 into pG1D at the common XbaI site. | Peter Devreotes |
| 284 | pGEG02-K | Rho GTPase (RacF2) knockout construct for KAX3 | Tetsuya Muramoto (Hideko Ursushihara) |
| 285 | pGEG02-V | Rho GTPase (RacF2) knockout construct for V12 | Tetsuya Muramoto (Hideko Ursushihara) |
| 193 | pGEG04-KAX3 | Hideko Urushihara | |
| 192 | pGEG04-V12 | Hideko Urushihara | |
| 190 | pGEG10 | Hideko Urushihara | |
| 827 | pGEM3+bsr | The plasmid was used to generate REMI mutagenesis. The plasmid was used for REMI, it is the pGEM3 plasmid (Promega) with a 1488bp blasticidin resistance cassette (Bsr). It contains a Dictyostelium actin 15 promoter and an actin 8 terminator sequence; the cassette was added at a SmaI site in pGEM3. | Jessica Kelsey / Daphne Blumberg |
| 996 | pGEMT_NrampB_CreBsr | floxed BsR cassette (from pLPBLP) inserted into the nrampB gene, cloned in pGEM-tEasy (Promega); may be linearized with EcoRI | Salvo Bozzaro |
| 561 | pGFP (1-21) | plasmid containing GFP tag for N-terminal fusion | Douwe Veltman |
| 18 | pGFP(S65T)-crtA | S65T-GFP-calreticulin in pDEXRH (G418) | Annette Muller-Taubenberger |
| 598 | pGFP-2FYVE | contains two copies of the FYVE domain from the human Hrs gene fused to the C-terminus of GFP in the Dictyostelium expression vector pTX-GFP; labels membranes enriched in phosphatidylinositol (3)-phosphate (early endosomes); NOTE, the attached map depicts the parental vector pTX-GFP | Margaret Clarke |
| 1089 | pGFP-CpnA | parent plasmid: pTX-GFP vector (11.2 kb), cpnA cDNA (1.8kb); cpnA cDNA is cloned into the SacI site of pTX-GFP; The cDNA clones of cpnA were subcloned into the SacI site of the pTX-GFP plasmid for the expression of the copine with a GFP tag at the N-terminus; | Amber Ide (Cynthia Damer) |
| 1091 | pGFP-CpnC | parent plasmid: pTX-GFP vector (11.2 kb), cpnC cDNA (1.6 kb); cpnC cDNA is cloned into the SacI site of pTX-GFP; The cDNA clones of cpnC were subcloned into the SacI site of the pTX-GFP plasmid for the expression of the copine with a GFP tag at the N-terminus | Amber Ide (Cynthia Damer) |
| 372 | pGFP-Golvesin | Golvesin with N-terminal GFP tag. | U. Mintert (G. Gerisch) |
| 373 | pGFP-Golvesin(1-558) | Golvesin with C-terminal deletion and N-terminal GFP tag. | U. Mintert (G. Gerisch) |
| 374 | pGFP-Golvesin-(L9A,L10A) | Full-length golvesin lacking the dileucine motif, with N-terminal GFP tag. | U. Mintert (G. Gerisch) |
| 382 | pGFP-MHC-3xALA | Expresses "3xALA" mutant version of Dictyostelium mhcA with GFP fused at N-terminus, driven by actin 15 promoter. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 383 | pGFP-MHC-3xASP | Expresses "3xASP" mutant version of Dictyostelium mhcA with GFP fused at N-terminus, driven by actin 15 promoter. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 801 | pGFP-pgkA | The gene coding for PgkA (DDB_G0287595) was amplified by RT-PCR using RNA isolated from growing cells. The fragment was then cloned into the XhoI-XbaI sites of the vector pTX-GFP (kindly deposited in the DSC by Tom Egelhoff).NOTE, the attached map depicts the parental vector pTX-GFP | Ricardo Escalante |
| 803 | pGFP-Tkt | The gene coding for Tkt-1 (DDB_G0272618) was amplified by RT-PCR using RNA isolated from growing cells. The fragment was then cloned into the XhoI-XbaI sites of the vector pTX-GFP (kindly deposited at the DSC by Tom Egelhoff). | Ricardo Escalante |
| 818 | pGFPsma | The plasmid was used to generate an overexpression of the gene, DDB_G0281803/sma. The rescue plasmid was constructed containing an N-terminal GFP coding sequence and a Gly-Pro-Gly linker sequence fused to the sma cDNA. The plasmid also contains an actin 15 promoter and terminator. The full length sma cDNA replaced the arp2/3 gene at BamHI and SacI restriction sites in the GFP-Arp2/pBIG plasmid. | Jessica Kelsey / Daphne Blumberg |
| 493 | pGMET-Easy-srfB-bsr | Knockout plasmid for srfB using blasticidin selection. | Leandro Sastre |
| 809 | pGolvesin-delta(76-118)-GFP | Golgi marker cloned into pDM358, a hygromycin-resistant extrachromosomal expression vector. | Daniel Dickinson / James Nelson and Bill Weis Lab |
| 369 | pGolvesin-GFP | Golvesin with C-terminal GFP tag | U. Mintert (G. Gerisch) |
| 370 | pGolvesin-GFP(76-118) | Core fragment of golvesin with C-terminal GFP tag. | U. Mintert (G. Gerisch) |
| 371 | pGolvesin-GFP(76-579) | Golvesin lacking the N-terminal 75 amino acids with C-terminal GFP tag. | U. Mintert (G. Gerisch) |
| 223 | pGP130-ura | knockout plasmid for gp130 (uracil cassette in genomic gp130) | Cathy Chia |
| 79 | pGSP1 | Extrachromosomal ACG expression vector (coding sequence of ACG inserted in pJK1). | Peter Devreotes |
| 452 | pGSP10 | ACA fragment from pGSP9 inserted into the Dictyostelium extrachromosomal expression vector pATANB43. pGSP10 was used to generate aca-/ACA cells. | Carole Parent |
| 91 | pGSP2 | Plasmid containing genomic fragment of ACA. | Peter Devreotes |
| 449 | pGSP6 | Jane Borleis (Devreotes) | |
| 451 | pGSP9 | Full-length genomic construct of ACA containing about 1 kb of 5-prime untranslated sequence. | Carole Parent |
| 807 | pGST-Aardvark | Doxycycline-inducible extrachromosomal expression vector for expression and purification of GST-Aardvark (aarA) from Dicty cultures. | Daniel Dickinson / James Nelson and Bill Weis Lab |
| 811 | pGST-alpha-catenin | E.coli expression vector (pGEX) for D. discoideum alpha-catenin (ctnnA). Protein is expressed as a TEV-cleavable GST fusion. | Daniel Dickinson / James Nelson and Bill Weis Lab |
| 819 | pGSTBAR | The plasmid was used to create a GST fusion product of the BAR domain in DB_G0272368/ndm.The BAR domain gene (amino acids 1376 ? 1618) segment of DDB_G0272368/ndm was cloned into a pGEX-6P-1 vector (GE Healthcare). The pGEX-6P-1 contains a tac promoter and lacIq gene for inducible expression by Isopropyl beta-D-1-thiogalactopyranoside (IPTG), and also a GST fusion protein tag for placement on the N-terminus of the protein segment. | Jessica Kelsey / Daphne Blumberg |
| 820 | pGSTCAST | The plasmid was used to create a GST fusion product of the CAST domain in DDB_G0272368/ndm. The CAST domain gene (amino acids 650 ? 1628) segment of DDB_G0272368/ndm was cloned into a pGEX-6P-1 vector (GE Healthcare). The pGEX-6P-1 contains a tac promoter and lacIq gene for inducible expression by Isopropyl beta-D-1-thiogalactopyranoside (IPTG), and also a GST fusion protein tag for placement on the N-terminus of the protein segment. | Jessica Kelsey / Daphne Blumberg |
| 821 | pGSTGBD | The plasmid was used to create a GST fusion product of the GBDs domain in DDB_G0272368/ndm. The GBD domain gene (amino acids 163 ? 921) segment of DDB_G0272368/ndm was cloned into a pGEX-6P-1 vector (GE Healthcare). The pGEX-6P-1 contains a tac promoter and lacIq gene for inducible expression by Isopropyl beta-D-1-thiogalactopyranoside (IPTG), and also a GST fusion protein tag for placement on the N-terminus of the protein segment. | Jessica Kelsey / Daphne Blumberg |
| 1047 | pGWDI-C4 | The sequences directly upstream and downstream of the BamHI sites were mutated to contain an MmeI site, an I-sceI site and a specific vector index. Using these vectors, the GWDI insert sequences were amplified using the T3 and T7 primers. They comprise a blasticidin resistance gene with promoter and terminator sequences and left and right border arms. In addition to these, we also generated GWDI-C inserts, which have -CATG sticky ends generated by SphI cleavage. The arms terminate in 4 base overhangs after restriction enzyme digestion. The inserts and their arms can be distinguished by unique 6 bp indices; parent plasmid: pLPBLP | Amy Baldwin (Hardwood and Thompson labs) |
| 1048 | pGWDI-C6 | The sequences directly upstream and downstream of the BamHI sites were mutated to contain an MmeI site, an I-sceI site and a specific vector index. Using these vectors, the GWDI insert sequences were amplified using the T3 and T7 primers. They comprise a blasticidin resistance gene with promoter and terminator sequences and left and right border arms. In addition to these, we also generated GWDI-C inserts, which have -CATG sticky ends generated by SphI cleavage. The arms terminate in 4 base overhangs after restriction enzyme digestion. The inserts and their arms can be distinguished by unique 6 bp indices; parent plasmid: pLPBLP | Amy Baldwin (Hardwood and Thompson labs) |
| 1050 | pGWDI-C7 | The sequences directly upstream and downstream of the BamHI sites were mutated to contain an MmeI site, an I-sceI site and a specific vector index. Using these vectors, the GWDI insert sequences were amplified using the T3 and T7 primers. They comprise a blasticidin resistance gene with promoter and terminator sequences and left and right border arms. In addition to these, we also generated GWDI-C inserts, which have -CATG sticky ends generated by SphI cleavage. The arms terminate in 4 base overhangs after restriction enzyme digestion. The inserts and their arms can be distinguished by unique 6 bp indices; parent plasmid: pLPBLP | Amy Baldwin (Hardwood and Thompson labs) |
| 1049 | pGWDI-C8 | The sequences directly upstream and downstream of the BamHI sites were mutated to contain an MmeI site, an I-sceI site and a specific vector index. Using these vectors, the GWDI insert sequences were amplified using the T3 and T7 primers. They comprise a blasticidin resistance gene with promoter and terminator sequences and left and right border arms. In addition to these, we also generated GWDI-C inserts, which have -CATG sticky ends generated by SphI cleavage. The arms terminate in 4 base overhangs after restriction enzyme digestion. The inserts and their arms can be distinguished by unique 6 bp indices; parent plasmid: pLPBLP | Amy Baldwin (Hardwood and Thompson labs) |
| 1044 | pGWDI-G1 | The sequences directly upstream and downstream of the BamHI sites were mutated to contain an MmeI site, an I-sceI site and a specific vector index. Using these vectors, the GWDI insert sequences were amplified using the T3 and T7 primers. They comprise a blasticidin resistance gene with promoter and terminator sequences and left and right border arms.The resulting GWDI-G inserts have GATC- sticky ends generated by BamHI cleavage. The arms terminate in 4 base overhangs after restriction enzyme digestion. The inserts and their arms can be distinguished by unique 6 bp indices. | Amy Baldwin (Hardwood and Thompson labs) |
| 1045 | pGWDI-G2 | The sequences directly upstream and downstream of the BamHI sites were mutated to contain an MmeI site, an I-sceI site and a specific vector index. Using these vectors, the GWDI insert sequences were amplified using the T3 and T7 primers. They comprise a blasticidin resistance gene with promoter and terminator sequences and left and right border arms.The resulting GWDI-G inserts have GATC- sticky ends generated by BamHI cleavage. The arms terminate in 4 base overhangs after restriction enzyme digestion. The inserts and their arms can be distinguished by unique 6 bp indices; parent plasmid: pLPBLP | Amy Baldwin (Hardwood and Thompson labs) |
| 1051 | pGWDI-G3 | The sequences directly upstream and downstream of the BamHI sites were mutated to contain an MmeI site, an I-sceI site and a specific vector index. Using these vectors, the GWDI insert sequences were amplified using the T3 and T7 primers. They comprise a blasticidin resistance gene with promoter and terminator sequences and left and right border arms.The resulting GWDI-G inserts have GATC- sticky ends generated by BamHI cleavage. The arms terminate in 4 base overhangs after restriction enzyme digestion. The inserts and their arms can be distinguished by unique 6 bp indices; parent plasmid: pLPBLP | Amy Baldwin (Hardwood and Thompson labs) |
| 1046 | pGWDI-G5 | The sequences directly upstream and downstream of the BamHI sites were mutated to contain an MmeI site, an I-sceI site and a specific vector index. Using these vectors, the GWDI insert sequences were amplified using the T3 and T7 primers. They comprise a blasticidin resistance gene with promoter and terminator sequences and left and right border arms.The resulting GWDI-G inserts have GATC- sticky ends generated by BamHI cleavage. The arms terminate in 4 base overhangs after restriction enzyme digestion. The inserts and their arms can be distinguished by unique 6 bp indices; parent plasmid: pLPBLP | Amy Baldwin (Hardwood and Thompson labs) |
| 69 | PH-GFP (pWf38) | 700-bp N-terminal PH domain of CRAC fused to GFP, by cloning it into the GFP expression vector pb15rsGFP. This gives constitutive expression under the control of the actin 15 promoter. | Peter Devreotes |
| 721 | PH-PLCδ1-GFP | Used for live cell microscopy, labels membranes containing PI(4,5)P2. | Margaret Clarke |
| 964 | pHO167 | calnexinA-YFP-FKBP (cnxA) overexpression construct; anchor at the ER to trap baits upon rapamycin addition; parental vector: pDXA-YFP-MCS | Oliver Hoeller / Orion Weiner |
| 965 | pHO232 | calnexinA-CFP-FKBP overexpression construct; anchor to trap proteins at the ER upon Rapamycin treatment; parental vector: pDXA-YFP modified | Oliver Hoeller / Orion Weiner |
| 968 | pHO313 | overexpression of RFP-pten; parental vector: pDM451 | Oliver Hoeller / Orion Weiner |
| 971 | pHO34 | myrostylation tag(SRC) YFP- FRB for overexpression; anchor to stick proteins to the plasma membrane upon Rapamycin treatment; parental vector: pDXA-YFP | Oliver Hoeller / Orion Weiner |
| 972 | pHO39 | carA-RFP- FRB for overexpression; anchor to stick proteins to the plasma membrane upon Rapamycin treatment; parental vector: pDXA-YFP modified | Oliver Hoeller / Orion Weiner |
| 963 | pHO536 | FRB-RFP-Gbeta (gpbA) overexpression construct; bait to trap Gbeta at the ER upon rapamycin addition; parental vector: pDM448 | Oliver Hoeller / Orion Weiner |
| 970 | pHO57 | YFP-pikA (N-terminal region: aa170-290) overexpression construct; parental vector pDXA-YFP | Oliver Hoeller / Orion Weiner |
| 969 | pHO578 | doxycycline-inducible variant of GFP-Rac1A(V12); parental vector: pDM369 | Oliver Hoeller / Orion Weiner |
| 602 | pHYG-tgrC1-KO | tgrC1 knock-out plasmid | Rocio Benabentos (Shaulsky Lab) |
| 453 | pHygTm(plus)/pG7 | Vector containing new hygromycin Bam cassette with cabA terminator. EcoR1 and BglII within Hyg were killed by mutagenesis. Made by Masashi Fukusawa (pers. commun. Jeff Williams, 5-8-08) | Susan Ross (Jeff Williams) |
| 305 | pi3k2-gfp | Reporter construct: pi3k2 ligated to GFP and expressed in EXP-4(+) | Jane Borleis |
| 375 | piaA-HSB1 | Mutated form of the piaA gene, containing the temperature-sensitive mutation, isolated from the mutant HSB1 and inserted into pBlueScript. | Salvo Bozzaro |
| 289 | piaAWT | Pianissimo expression vector used to rescue the HSB1 strain. Insert is most likely in pMyc86/6, but could also be in pBluescript. | Salvatore Bozzaro |
| 510 | pik4::bsr | Remi rescued plasmid from rasC-/pik4- cells (pikD knockout vector) | P. Bolourani (G. Weeks) |
| 720 | pIpkA1-OE | ipkA1 overexpression vector with an N-terminal FLAG tag; the parental vector is ptx-FLAG | Regina Teo (Adrian Harwood) |
| 913 | pIqgD-REMI | IqgD REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:5941744 | Christopher Quang Dung Dinh/Adam Kuspa |
| 862 | pIrlB-1-REMI | irlB-1 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:2540818 | Christopher Quang Dung Dinh/Adam Kuspa |
| 719 | pItpk1-OE | itpk1 overexpression vector | Regina Teo (Adrian Harwood) |
| 349 | pJB1 | pyr5-6 gene (ClaI fragment of pDU3B1) in pBluescript. | Jane Borleis (Devreotes) |
| 350 | pJB22 | gufB (Gene of Unknown Function) | J. Franke/R. Kessin |
| 188 | pJH138 | Gα4-KO construct (Gα4::pyr5-6) | Jeff Hadwiger |
| 125 | pJH154 | BamHI genomic fragment (4.2 kb) containing the entire Gα4 gene (including promoter, terminator, etc.) cloned into BamHI site of pT3T718U (Pharmacia). A 2.2-kb EcoRI-BamHI neoR cassette from B10SX was inserted into EcoRI site. | Jeff Hadwiger |
| 126 | pJH161 | Gα4::lacZ fusion containing the promoter and first 17 codons of Gα4 gene. Inserted into pAT153L cloning vector. Also contains a neoR cassette (EcoRI fragment). | Jeff Hadwiger |
| 127 | pJH206 | XhoI-BclI genomic fragment (3.1 kb) containing entire Gα5 gene (including promoter, terminator, etc.) cloned into pT3T718U with added BclI site (Pharmacia). A 2.2kb EcoRI-BamHI neoR cassette from B10SX was inserted into EcoRI site. | Jeff Hadwiger |
| 128 | pJH210 | Gα5::lacZ fusion containing the promoter and first 14 codons of Gα5 gene. Inserted into pAT153L cloning vector. Also contains a neoR cassette (EcoRI fragment). | Jeff Hadwiger |
| 129 | pJH214 | PCR segment of the Gα5 gene that was later disrupted with the Thy1 gene to yield vector pJH216. | Jeff Hadwiger |
| 454 | pJH216 | Gα5 gene knockout construct (gα5::Thy1). Thy1 gene replaces a PstI-SpeI fragment in Gα5 genomic fragment. Excise gene disruption fragment with EcoRV-EcoRI digest. | Jeff Hadwiger |
| 456 | pJH280 | HindIII/KpnI frag from pUCBsrBam inserted into the same sites of pBluescript SK- (Stratagene). Many restriction sites available for excising Bsr gene. Reference for pUCBsrBam - Adachi H, Hasebe T, Yoshinaga K, Ohta T, Sutoh K. (1994) Isolation of Dictyostelium discoideum cytokinesis mutants by restriction enzyme-mediated integration of the blasticidin S resistance marker. Biochem Biophys Res Commun. 205:1808-14. | Jeff Hadwiger |
| 455 | pJH48 | Pyr5-6 gene with SalI linker inserted at PvuII site, can be excised with Asp718 and used to create pyr5-6- mutants (e.g., JH8) | Jeff Hadwiger |
| 1054 | pJH693 | Digest with XhoI and HindIII to insert blasticidin resistance gene; Total vector length: 5.5kb; DictyBase gene: erk1(DDB_G0286353); Bacteria used: DH5alpha; | Jeff Hadwiger |
| 1053 | pJH770 | Digest with XhoI and XbaI; Total vector length: 7kb; DictyBase genes: erk2(DDB_G0269918), thyA(DDB_G0280045); Plasmid reistance marker: thyA | Jeff Hadwiger |
| 21 | pJK1 | Extrachromosal vector containing a neoR cassette derived from the Ddp1-based vector pATANB43 (Pmid 2813371) into which the actin15 promoter and the 2H3 terminator have been inserted. | Peter Devreotes |
| 22 | pJK3 | cAR1 cDNA cloned in the extrachromosomal expression vector pJK1 | Peter Devreotes |
| 388 | pJR1 | Karl Saxe | |
| 445 | pJRC119 | GFP-Set1 rescue construct (in pDEXH82). | Jonathan Chubb |
| 444 | pJRC13 | Set1 bsr disruption plasmid | Jonathan Chubb |
| 347 | pJRC36 | dscA MS2-tagging vector | Jonathan Chubb |
| 348 | pJRC76 | MS2-GFP expression vector | Jonathan Chubb |
| 446 | pJRC88 | GFP-Set1:C147A construct (in pDEXH82) | Jonathan Chubb |
| 447 | pJRC89 | GFP-Set1:N142Q construct (in pDEXH82). | Jonathan Chubb |
| 458 | pJSK19 | Myc-tagged Dictyostelium replacement Arp2 expressed in pRHI76. | Mehreen Zaki (Rob Insall) |
| 993 | pJSK471 | LoxP-Blasticidin Atg1 KO construct; 7688 bp; insert length: 3286 bp; parental vector: pDM368; plasmid resistance marker (bacterial): kanamycin | Jason King |
| 987 | pJSK489 | GFP-Atg18 expression plasmid; total vector length: 8930 bp; insert length: 1125 bp; parental vector: pDM448 | Jason King |
| 995 | pJSK498 | GFP-Atg8/ TagRFP-atg18 co-expression plasmid; atg18 length: 1125 bp; vmp1 length: 375 bp; parental vector: pJSK468 | Jason King |
| 988 | pJSK542 | GFP-Atg18/vmp1-RFP co-expression plasmid; atg18 length: 1125 bp; vmp1 length: 1218 bp; parental vector: pDM451 | Jason King |
| 989 | pJSK613 | GFP-vps5 expression plasmid; total vector length: 9440 bp; insert length: 1653 bp; parental vector: pDM448 | Jason King |
| 994 | pJSK614 | GFP-vps29 expression plasmid; total vector length: 8360 bp; insert length: 555 bp; parental vector: pDM448 | Jason King |
| 991 | pJSK621 | SibC-GFP expression plasmid; total vector length: 12831 bp; insert length: 5871 bp; parental vector: pDM1045 | Jason King |
| 405 | pK-neo | Dd PK2 protein kinase over-expression vector. | Christophe Anjard |
| 886 | pKcnma1-REMI | kcnma1 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:3814380 | Christopher Quang Dung Dinh/Adam Kuspa |
| 978 | pKF3/KrsB-GFP | Used to overexpress KrsB; KrsB was cloned into BgIII+XhoI of pKF3 (in font of GFP); BgIII site destroyed; total vector length: 11.8 kb; insert length: 4.4 kb; parental vector: pKF3 | Yulia Artemenko (Devreotes Lab) |
| 1071 | pKIF1A-pTM1285 | Extrachromosomal expression vector; EGFP- tag; G418 resistance; parent plasmid, PTM1258, digested with BpiI and KIF1A gRNA sequence inserted between two BpiI sites; CRISPR/Cas9 all-in-one vector | Yan You (Jin Lab) |
| 245 | pKK4 | Tandem affinty purification (TAP) vector. | Katrin Koch (R. Graf) |
| 450 | pKL2 | ACA fragment from pGSP9 inserted in the Dictyostelium expression vector pB18. pKL2 was used to generate aca-/ACAact-15 cells. | Carole Parent |
| 834 | pKL4 | Contains the AmpA promoter + coding sequence and the TAP tag fused in frame to the C terminus of AmpA and inserted between KpnI and XhoI with the AmpA ~200bp terminator immediately downstream in the Xho-HindIII site. ? The AmpA promoter, coding region and in frame fusion to the Tap tag was excised from pKL1 by Kpn I ? XhoI and subcloned into the pKL3 plasmid at the KpnI-XhoI site so that the AmpA terminator sequence was immediately downstream of the AmpA-Tap tag fusion protein gene. This generated plasmid pKL4. | Beth Noratel / Daphne Blumberg |
| 833 | pKL5 | ? pKL4 with the flox blasticidin cassette and the AmpA 3? region digested from pKL2 and inserted between HindIII and NotI. ? AmpA-TAP Tag with AmpA terminator, Floxed-blastocidin resistance cassette and 1Kb of sequence from downstream of the AmpA gene. This plasmid construct was transformed as a circular plasmid to generate a strain that makes excess AmpA-Tap tag fusion protein and gives an AmpA overexpresser phenotype. The KpnI ?NotI fragment has been used to generate single copy knock In constructs of the AmpA-tap tag fusion protein selecting for recombination between the upstream AmpA regions and the 1+Kb 3? non coding region of the AmpA gene. The construct was used for both westerns and immunofluorescence. The Tap Tag is placed at the C-Terminal end of AmpA. The AmpA 3? downstream region from the AmpA termination codon to a site ~1000 base pairs downstream was PCR amplified. The 5? primer containing a Bam H1 site (underlined) was 5? AAGGGAACAAAAGCTGGAGGATCCATG and the 3? primer containing a Not I site (underlined) was 5? TCAAGGATGAGCGGC CGCAATTCTCTATGGTCAACATTA. This PCR fragment was ligated into pLPBLP (Kimmel 2006) at the BamH1 Not1 site. This plasmid contains the floxed blasticidin cassette at the BamH1-Hind III site and the AmpA terminator, Tap tag fused in frame to the AmpA coding sequence and the full ampA promoter region as a Hind III- KpnI fragment. | Beth Noratel / Daphne Blumberg |
| 1078 | pKnkA-KO | Construct used for knockout of DDB_G0271880 (knkA);Inserts cloned into pLPBLP with SalI/HindIII (5' insert) and PstI/BamHI (3' insert);parent vector: pLPBLP;insert lengths: 1.2 kb + 1 kb | Gillian Forbes (Schaap Lab) |
| 485 | pLAI7 | apm4-knockout construct. PCR-amplified 3' and 5' regions of apm4 (mu4 or µ4), with a bsR cassette inserted in between, in pBluescript. | Francois Letourneur |
| 441 | pLAS103 | Plasmid rescued with EcoRI from cheater mutant LAS103. Remi insertion in gene DDB_G0280089 (unknown function). | Elizabeth Villegas (Gad Shaulsky) |
| 419 | pLAS18 | Plasmid rescued with EcoRI from cheater mutant LAS18. Non-intragenic REMI insertion near rab7B (Rab GTPase). | Elizabeth Villegas (Gad Shaulsky) |
| 420 | pLAS19 | Plasmid rescued with EcoRI from cheater mutant LAS19. Remi insertion in pks26 (putative polyketide synthase; beta-ketoacyl synthase family protein). | Elizabeth Villegas (Gad Shaulsky) |
| 421 | pLAS26 | Plasmid rescued with BglII from cheater mutant LAS26. Remi insertion in DDB_G0277239 (Non-receptor tyrosine kinase spore lysis A (EC 2.7.1.112) (Tyrosine-protein kinase 1). | Elizabeth Villegas (Gad Shaulsky) |
| 422 | pLAS27 | Plasmid rescued with BglII from cheater mutant LAS27. Non-intragenic remi insertion near DDB_G0280203. | Elizabeth Villegas (Gad Shaulsky) |
| 423 | pLAS29 | Plasmid rescued with BglII from cheater mutant LAS29. Remi insertion in DDB_G0273201 (DNA-binding HORMA domain-containing protein; mitotic spindle assembly checkpoint protein). | Elizabeth Villegas (Gad Shaulsky) |
| 408 | pLAS3 | Plasmid rescued with EcoR1 from cheater mutant LAS3 (DDB0187308; putative ubiquitin-conjugating enzyme E2). | Elizabeth Villegas (Gad Shaulsky) |
| 424 | pLAS31 | Plasmid rescued with BglII from cheater mutant LAS31. Remi insertion in pikG (phosphatidylinositol 3-kinase; PI3kinase). | Elizabeth Villegas (Gad Shaulsky) |
| 425 | pLAS32 | Plasmid rescued with BglII from cheater mutant LAS32. Remi insertion in docA (timA, DG1012, DG2016). SH3 domain-containing protein; DOCK family protein; putative guanine nucleotide exchange factor (GEF). Similar to H. sapiens DOCK180 protein. | Elizabeth Villegas (Gad Shaulsky) |
| 426 | pLAS34 | Plasmid rescued with BglII from cheater mutant LAS34. Remi insertion in DDB_G0278585 (unknown function). | Elizabeth Villegas (Gad Shaulsky) |
| 427 | pLAS38 | Plasmid rescued with BglII from cheater mutant LAS38. Non-intragenic REMI insertion (DDB0202322, DDB0202324). | Elizabeth Villegas (Gad Shaulsky) |
| 428 | pLAS39 | Plasmid rescued with BglII from cheater mutant LAS39. Remi insertion in DDB_G0292148 (Arf GTPase activating protein). | Elizabeth Villegas (Gad Shaulsky) |
| 429 | pLAS43 | Plasmid rescued with SpeI from cheater mutant LAS43. Remi insertion in DDB_G0274431 (hypothetical 127.0 kDa protein). | Elizabeth Villegas (Gad Shaulsky) |
| 430 | pLAS44 | Plasmid rescued with SpeI from cheater mutant LAS44. Remi insertion in pks2- (putative polyketide synthase; beta-ketoacyl synthase family protein). | Elizabeth Villegas (Gad Shaulsky) |
| 431 | pLAS49 | Plasmid rescued with BglII from cheater mutant LAS49. Non-intragenic remi insertion near genes DDB_G0273325 and DDB_G0273271. | Elizabeth Villegas (Gad Shaulsky) |
| 415 | pLAS5 | Plasmid rescued with EcoRI from cheater mutant LAS5. GeneDDB0191519 (rsc6) REMI mutant; similar to heat shock protein Hsp20 domain-containing protein; but does not contain a Hsp20 domain | Elizabeth Villegas (Gad Shaulsky) |
| 432 | pLAS51 | Plasmid rescued with BglII from cheater mutant LAS51. Non-intragenic REMI insertion near gene DDB_G0285547 (unknown function). | Elizabeth Villegas (Gad Shaulsky) |
| 434 | pLAS53 | Plasmid rescued with EcoRI from cheater mutant LAS53. Remi insertion in abkD (putative protein serine/threonine kinase; ABC1 family protein kinase; ABC1-B subfamily protein kinase). Contains ABC1 kinase (protein kinase-like) domain; yeast ABC1 essential for the electron transfer in the BC(1) complex; E.coli homolog required for ubiquinone biosynthesis). | Elizabeth Villegas (Gad Shaulsky) |
| 433 | pLAS54 | Plasmid rescued with EcoRI from cheater mutant LAS54. Remi insertion in gene DDB_G0280299 (unkown function). | Elizabeth Villegas (Gad Shaulsky) |
| 435 | pLAS57 | Plasmid rescued with EcoRI from cheater mutant LAS57. Non-intragenic remi insertion between genes DDB_G0268864 and DDB_G0268866 (unknown functions). | Elizabeth Villegas (Gad Shaulsky) |
| 436 | pLAS58 | Plasmid rescued with EcoRI from cheater mutant LAS58. Non-intragenic remi insertion between DDB_G0284973 and tpsB (glycosyltransferase α,α-trehalose-phosphate synthase trehalose 6-phosphate synthase trehalose-phosphatase) | Elizabeth Villegas (Gad Shaulsky) |
| 416 | pLAS6 | Plasmid rescued with EcoRI from cheater mutant LAS6. Remi insertion between genes DDB0203824 (DDB_G0276383) and DDB0201646 (pyr1-3). | Elizabeth Villegas (Gad Shaulsky) |
| 437 | pLAS60 | Plasmid rescued with ClaI from cheater mutant LAS60. Non-intragenic remi insertion between genes DDB_G0285935 and helD (DEAD/DEAH box helicase; putative RNA splicing factor). Conserved RNA helicase; S. cerevisiae prp16 involved in the second catalytic step of splicing, exhibits ATP-dependent RNA unwinding activity. | Elizabeth Villegas (Gad Shaulsky) |
| 417 | pLAS7 | Plasmid rescued with EcoRI from cheater mutant LAS7. Remi insertion in DDB_G0290685 (unknown gene product; highly repetitive protein: contains close to 100 repeats of the sequences DGENNQ, DGGENNQ, or very related sequences) | Elizabeth Villegas (Gad Shaulsky) |
| 438 | pLAS70 | Plasmid rescued with ClaI from cheater mutant LAS70. Remi insertion in DDB_G0279405 (putative protein serine/threonine kinase; CAMKK family protein kinase; Meta subfamily protein kinase). | Elizabeth Villegas (Gad Shaulsky) |
| 418 | pLAS8 | Plasmid rescued with EcoRI from cheater mutant LAS8. Remi insertion in . Similar to Oryza sativa (Japonica cultivar-group). Putative zinc transporter protein ZIP1. | Elizabeth Villegas (Gad Shaulsky) |
| 439 | pLAS91 | Plasmid rescued with EcoRI from cheater mutant LAS91. Remi insertion in abcC9 (ABC transporter C family protein). | Elizabeth Villegas (Gad Shaulsky) |
| 440 | pLAS99 | Plasmid rescued with EcoRI from cheater mutant LAS99. Remi insertion in dhkE (histidine kinase; protein kinase, atypical group; HisK family protein kinase). | Elizabeth Villegas (Gad Shaulsky) |
| 310 | pLD1A15SN | Modified pLD1 vector which contains the Ddp2-based origin of replication. | Doug Robinson |
| 298 | pLD1A15SN:dynhp | Expression vector for dynacortin hairpin construct. | Doug Robinson |
| 466 | pLD1A15SN:fimbrin RNAi | Expression vector for fimbrin RNAi hairpin | Doug Robinson |
| 467 | pLD1A15SN:GFP-fimbrin | Expression vector for GFP-fimbrin | Doug Robinson |
| 297 | pLD1A15SN:GFPdynacortin | Doug Robinson | |
| 309 | pLD1A15SN:myoIIhp | Expression vector for myosin II hairpin construct. | Doug Robinson |
| 122 | pLittle | Autonomous replicating extrachromosomal expression vector with G418 cassette, derived from pBIG by the removal of a 1.3-kb KpnI fragment. | Tom Egelhoff |
| 822 | pLMBD2B-ko | Plasmid to knockout the gene, lmbd2b. The original REMI plasmid (pGEM3) with flanking lmbd2B genomic DNA linearized with ClaI was used to create knockout strains in Wt, ampAOE and ampA- backgrounds. The pGEM3 plasmid which has a 1488bp blasticidin resistance cassette (added at a SmaI site) was linearized by BamHI and incorporated into the DDB_G0281669/lmbd2B gene. The LMBD2Bko plasmid was removed using ClaI to include flanking gene DNA, sufficient to create future lmbd2B gene knockouts. | Jessica Kelsey / Daphne Blumberg |
| 861 | pLmpB-REMI | lmpB REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:5254791 | Christopher Quang Dung Dinh/Adam Kuspa |
| 843 | pLox-NeoI-RegA | Plasmid for knocking out regA in Polysphondylium pallidum; parent: pLoxNeoI (DSC: 589) | Qingyou Du (Pauline Schaap) |
| 589 | pLoxNeoI | contains G418 cassette and loxP sequence; parent: pUC19 | Yoshinori Kawabe (Pauline Schaap) |
| 590 | pLoxNeoII | contains G418 cassette and loxP sequence; parent: pUC19 | Yoshinori Kawabe (Pauline Schaap) |
| 1085 | pLoxNeoIII | Contains G418 cassette and loxP sequence. Made by filling in XbaI site of pLoxNeoI, followed by recloning of the pLoxNeo fragment into pBluescript SK- using the BamHI and HindIII sites. This construct has a greater choice of restriction sites for cloning; total vector length: 5.402 kb | |
| 805 | pLP122 | Plasmid expressing an N-terminal GFP tag followed by the wshA coding sequence. The expressed fusion protein demonstrates the expected localization in Dictyostelium cells, and rescues the phenotype of the wshA-null mutant. | Peter Thomason / Rob Insall |
| 992 | pLP151 | GFP-WASH/RFP-vps5 co-expression plasmid; WASH length: 1416 bp; VPS5 length: 1635 bp; parental vector: pDM448 | Jason King |
| 9 | pLPBLP | Plasmid containing Bsr cassette with LoxP sites for generating multiple gene disruptions. | Jan Faix |
| 475 | pMars-LimE-delta-coil | RFPmars-limE-delta-coil fusion plasmid containing a blasticidin resistance marker; LimE-delta-coil cloned into the EcoRI site of plasmid 339-3 (mRFPmars in pBsrH) | David Knecht (Annette Mueller-Taubenberger) |
| 44 | pMB35 | Transactivator plasmid containing the tTAs* gene under the control of A15P and 2H3T; tet-off | Mieke Blaauw (Peter van Haastert) |
| 264 | pMB35-M2 | tetON drive; both tetON and tetOFF systems exist for Dicty. The tetOFF system was pioneered by Dingermann and colleagues, but the most frequently used vectors are those constructed by Blaauw et al., Gene 252:71-82, 2000. The Dicty tetON system is derived from yeast vectors described in Urlinger et al., PNAS 97:7963-8, 2000; the rtTa-M2 element was recloned into the Blaauw vector MB35 by Adriano Ceccarelli, and students in my lab have shown that the performance of this tetON system in Dicty (induction factor, response time) is similar to that of the tetOFF system. Both the original tetOFF MB35 and its tetON version are neo vectors. In practice one needs a Dicty strain carrying one or the other of these, which one overtransforms with a second, blasticidin vector (Blauuw et al. MB38) carrying the gene of interest. Once one has cloned one's gene into MB38, it can be overtransformed into both tetON and tetOFF strains. Both MB35 and MB38 are in the stock center, as are cells containing MB35. H. MacWilliams | Harry MacWilliams |
| 45 | pMB38 | pMB38 is a cloning vector for the gene of interest. Extrachromosomal response plasmid containing the inducible promoter TRE-Pmin upstream of the 2H3T terminator with 4 unique restriction sites in between. Both tetON and tetOFF systems exist for Dicty. The tetOFF system was pioneered by Dingermann and colleagues, but the most frequently used vectors are those constructed by Blaauw et al., Gene 252:71-82, 2000. The Dicty tetON system is derived from yeast vectors described in Urlinger et al., PNAS 97:7963-8, 2000; the rtTa-M2 element was recloned into the Blaauw vector MB35 by Adriano Ceccarelli, and students in my lab have shown that the performance of this tetON system in Dicty (induction factor, response time) is similar to that of the tetOFF system. Both the original tetOFF MB35 and its tetON version are neo vectors. In practice one needs a Dicty strain carrying one or the other of these, which one overtransforms with a second, blasticidin vector (Blauuw et al. MB38) carrying the gene of interest. Once one has cloned one's gene into MB38, it can be overtransformed into both tetON and tetOFF strains. Both MB35 and MB38 are in the stock center, as are cells containing MB35. H. MacWilliams | Mieke Blaauw (Peter van Haastert) |
| 841 | pMB74 | Expression construct under control of the actin15 promoter | |
| 842 | pMB74GFP | GFP expression construct under control of the actin15 promoter | |
| 392 | pMBP-Aur | Full-length DdAurora cDNA cloned in bacterial vector pMal-c2X (NEB) for protein purification in E. coli. N-terminal MBP tag; ampR. | Arturo De Lozanne |
| 19 | pMC25 | cAR1 gene disruption construct (ura selection): 2-kb region immediately upstream of cAR1 coding region and 0.4-kb 3'coding region plus 0.1-kb 3'non-translated region subloned into pBluescript-SK. 3.7-kb ClaI fragment from pDU3B1 was subloned between the fragments. | Peter Devreotes |
| 20 | pMC34 | cAR1 cDNA minus first 2 codons, (nt 97-1312), cloned into the BglII site of pJK1 | Peter Devreotes |
| 71 | pMC36 | cAR1 cDNA in the BglII site of pJK1 | Peter Devreotes |
| 916 | pMed23-REMI | Med23 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:4869190 | Christopher Quang Dung Dinh/Adam Kuspa |
| 661 | pMidA-KO | Mid A KO vector; dicty resistance marker is blasticidin; bacterial resistance marker is Ampicillin; parental vector is pGEMt from PROMEGA | Ricardo Escalante |
| 102 | pMKC-Hyg1 | myosin heavy chain knockout vector containing hygromycin resistance cassette | Tom Egelhoff |
| 808 | pmRFP-dcsA | Vector for the expression of mRFP-tagged cellulose synthase (dcsA) under the control of its own promoter. The actin 15 promoter in pDM358 has been replaced by the dcsA promoter. | Daniel Dickinson / James Nelson and Bill Weis Lab |
| 1 | pmRFPmars | Synthetic brilliant red fluorescent protein, mRFPmars. The last amino acid that belongs to mRFPmars sequence in the 339-3 vector is A. G and S correspond to the BamHI restriction site, E and F to the EcoRI restriction site. There is no His-tag encoded by 339-3 as this is made for expression in Dictyostelium. The sequence you insert into the MCS has to end with a stop codon as there is no stop present in the sequence. | Annette Muller-Taubenberger |
| 904 | pMscS-REMI | MscS REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:7824434 | Christopher Quang Dung Dinh/Adam Kuspa |
| 976 | pMUW110 | pMUW100 encodes the Rep protein; Ddp2 ori; ColE1 ori; beta-lactamase; neomycin resistance gene | |
| 975 | pMUW1630 | The extrachromosomal plasmid pMUW1630 carries the expression cassette consisting of a strong act15 promotor and polyadenylation signal, secretion signal of the PsA protein, and multiple cloning site. | |
| 77 | pMYC-86-6 | Vector expressing the piaAWT gene (full-length piaA cDNA). See d6652, PhD Thesis of M.Y. Chen. | Peter Devreotes |
| 75 | pMYC4 | Plasmid for generating Gα1/Gα2 chimeras (backbone is pBluescript KS-). | Peter Devreotes |
| 76 | pMYC5 | Plasmid for generating Gα2/Gα1 chimeras (backbone is pBluescript KS-). | Peter Devreotes |
| 323 | pmycELC | ELC (essential myosin light chain) cDNA tagged with a 30-base myc sequence at the 3'end, introduced in expression vector pBORP. | Rex Chisholm |
| 240 | pN-CAP-Pro-GFP | N-terminal domain of CAP (containing the proline-rich region) cloned in frame with GFP in pDdA15gfp. | Angelika Noegel |
| 13 | pNcsA | ncsA cDNA in PET15b (NcsA protein) | Barrie Coukell |
| 16 | pNcsA-KO | ncsA cDNA clone (SSL268) in pBluescript KS - with the blasticidin S cassette from pBsR519 cloned into the ClaI site near the middle of the coding region. | Barrie Coukell |
| 825 | pNdm-ko | The original REMI plasmid (pGEM3) with flanking ndm genomic DNA linearized with ClaI was used to create knockout strains in Wt, ampAOE and ampA- backgrounds. The pGEM3 plasmid which has a 1488bp blasticidin resistance cassette (added at a SmaI site) was linearized by BamHI and incorporated into the DDB_G0272368/ndm gene. The NDMko plasmid was removed using ClaI to include flanking gene DNA, sufficient to create future ndm gene knockouts. | Jessica Kelsey / Daphne Blumberg |
| 967 | pOH250 | reporter construct for Ras activity; different specificity to generic Raf1(RBD); overexpression of pikA ras-binding domain fused to YFP; parental vector: pDXA-YFP modified | Oliver Hoeller / Orion Weiner |
| 966 | pOH271 | RFP-pikA overexpression construct; parental vector pDXA-YFP modified | Oliver Hoeller / Orion Weiner |
| 920 | pOrfR1062-REMI | OrfR1062 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:1665743 | Christopher Quang Dung Dinh/Adam Kuspa |
| 915 | pOrfR1062-REMI | OrfR1062 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:1666477 | Christopher Quang Dung Dinh/Adam Kuspa |
| 54 | pPatB-KO | patB (P-type H+-ATPase) gene disruption construct. | Barrie Coukell |
| 983 | pPB86 | Recently, Roux and co-workers published a method of proximity-dependent biotin identification (BioID), which is especially useful to identify putative interactors of insoluble proteins [Roux, 2012]. In this method bait proteins are tagged with a point mutated version of the E. coli biotinylase BirA (BirA-R118G), which promiscuously biotinylates any target protein in close proximity in vivo. Biotinylated proteins can then be identified and purified using suitable streptavidin conjugates and affinity chromatography media. This BirA-R118G vector for N-terminal fusions is based on the GFP-Vectors pIS76 (Bla). The complete BirA-R118G sequence flanked by NheI and SalI restriction sites was custom synthesized (GenArt, Thermo Fisher Scientific, Waltham, MA, USA), whereby each codon was replaced by the most common one based on the Dictyostelium codon bias table published on the genome project website (www.dictybase.org). GFP in pIS76 was then replaced by BirA-R118G using the NheI and SalI restriction sites yielding pPB86. This vector can be used for overexpression of BirA-R118G fusion proteins in Dictyostelium. The well-characterized actin6-promoter was chosen to drive expression of the bait protein, since its activity can be controlled by cell culture conditions. This vector can be used for BioID in Dictyostelium. Partental vector: pIS76; Insert/Vector Length: Insert BirA-R118G(991bp), vector 6012bp | Petros Batsios (AG Ralph Graef Lab) |
| 985 | pPB87 | Recently, Roux and co-workers published a method of proximity-dependent biotin identification (BioID), which is especially useful to identify putative interactors of insoluble proteins [Roux, 2012]. In this method bait proteins are tagged with a point mutated version of the E. coli biotinylase BirA (BirA-R118G), which promiscuously biotinylates any target protein in close proximity in vivo. Biotinylated proteins can then be identified and purified using suitable streptavidin conjugates and affinity chromatography media. This BirA-R118G vector for N-terminal fusions is based on the GFP-Vector pIS77 (G418), respectively [Schulz, 2009]. The complete BirA-R118G sequence flanked by NheI and SalI restriction sites was custom synthesized (GenArt, Thermo Fisher Scientific, Waltham, MA, USA), whereby each codon was replaced by the most common one based on the Dictyostelium codon bias table published on the genome project website (www.dictybase.org). GFP in pIS77 was then replaced by BirA-R118G using the NheI and SalI restriction sites yielding pPB87. This vector can be used for overexpression of BirA-R118G fusion proteins in Dictyostelium. The well-characterized actin6-promoter was chosen to drive expression of the bait protein, since its activity can be controlled by cell culture conditions. This vector can be used for BioID in Dictyostelium. Partental vector: pIS77; Insert/Vector Length: Insert BirA-R118G(991bp), vector 7593bp | Petros Batsios (AG Ralph Graef Lab) |
| 977 | pPCR4-TOPO-krsBKO | Plasmid used to knock out krsB; KrsBKO insert is first excised with SalI and NotI, and then amplified with the following primers: CGCGTCGACCTATTAATACAGGATAGGATCAACATCAC and CGCGCGGCCGCCTCACTCTTTGGTACATTAGTC, and the PCR product was transformed into AX2 cells; total vector length: 6.8 kb; insert length: 2.8 kb; parental vector: PCR4-TOPO | Yulia Artemenko (Devreotes Lab) |
| 879 | pPgtD-REMI | pgtD REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:1203720 | Christopher Quang Dung Dinh/Adam Kuspa |
| 92 | pPIA-HIS-GFP | A PiaA-eGFP expression vector containing a 2x proline linker and the hexyl histidine sequence. A full desription can be found on page 135 of the PhD thesis of J. Silverman (2004). | Peter Devreotes |
| 1079 | pPikfyve-KO | Construct used for knockout of DDB_G0279149 (pikfyve);Inserts cloned into pLPBLP with SalI/HindIII (5' insert) and PstI/BamHI (3' insert);parental vector: pLPBLP;insert lengths: 1.163 kb (5') + 1.238 kb (3');total vector length: 6.911 kb | Gillian Forbes (Schaap Lab) |
| 804 | pPK6 | acaA was tagged at the c-terminal end with YFP using a sph-1 linker. This construct was used for over-expressing ACA-YFP for fluorescent microscopy. | Paul Kriebel / Carole Parent |
| 222 | pPL3/lacZ | PL3 promoter-lacZ fusion construct (PL3 is prespore gene pspD encoding spore coat protein SP87) | Daphne Blumberg |
| 1007 | pPp-GSK3-OE | Overexpression of P.pallidum gskA driven by its own promoter; parental vector: pDdNYFP; insert length: 3.0kb; total vector length: 9.4kb | Yoshinori Kawabe (Pauline Schaap) |
| 241 | pPro-C-CAP-GFP | C-terminal domain of CAP (containing the proline-rich region) cloned in frame with GFP in pDdA15gfp. | Angelika Noegel |
| 354 | pPROF120 | Apoaequorin expression plasmid derived from pDNeo2. | Paul Fisher |
| 207 | pPROF128 | HspA (chaperonin 60) antisense construct in pDNeo2. | Paul Fisher |
| 596 | pPRX-GFP | expresses a fusion of GFP to the peroxisomal targeting sequence Ser-Lys-Leu-COOH, under the control of the actin-15 promoter. This plasmid brightly labels peroxisomes in Dictyostelium cells; based on pPRX?GFP | Margaret Clarke |
| 573 | pPsA-i-alpha-gal | psA promoter driving labile gal in V18Tn5DRE | Harry MacWilliams |
| 574 | pPsA-i-alpha-gal & pPSA-Ugus | psA promoter driving labile gal and stable gus | Harry MacWilliams |
| 572 | pPSA-labile-S65T-GFP | psA promoter driving short-lived GFP, in V18Tn5 backbone | Harry MacWilliams |
| 276 | pPsA-Rc | PsA::PKA-Rsubunit (Rc mutant does bind C subunit = control) expression vector | Adrian Harwood |
| 275 | pPsA-Rm | PsA::PKA-Rsubunit (Rm mutant) expression vector. | Adrian Harwood |
| 905 | pPsaA-REMI | PsaA REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:3844532 | Christopher Quang Dung Dinh/Adam Kuspa |
| 906 | pPsaA-REMI | PsaA REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:3844542 | Christopher Quang Dung Dinh/Adam Kuspa |
| 358 | pPT130 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 359 | pPT131 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 360 | pPT132 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 361 | pPT134 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 362 | pPT135 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 363 | pPT165 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 236 | pPT17 | D212N mutant regA "rescue" vector. | Rob Kay |
| 237 | pPT39 | GST-rdeA H63Q expression vector | Rob Kay |
| 238 | pPT40 | GST-rdeA H65Q expression vector (inactive mutant) | Rob Kay |
| 66 | pPTEN-GFP | The PTEN cDNA was cloned upstream of the start codon of the GFP gene. The resulting PTEN-GFP construct was inserted downstrean of the actin 15 promoter in the extrachromosomal vector pJK1. | Peter Devreotes |
| 67 | pPTEN-KO | pten KO vector | Peter Devreotes |
| 1073 | pPTX(act15/pyr56-mHtt-GFP) | Used for overexpression of Pyr56mHttGFP to enable genetic selection for polyglutamine aggregation mutants; total length 12.9 kb | Felicia Williams (Scaglione Lab) |
| 1080 | pPvio-cdl1-KO | Construct used for knockout of Pvio_g1607 (cdl1);Inserts cloned into pLoxP-NeoIII with KpnI/XhoI (5' insert) and BamHI/XbaI (3' insert);parental vector: pLoxP-NeoIII;insert lengths: 1.504 kb (5') + 1.851 kb (3'); total vector length: 8.732 kb | Gillian Forbes (Schaap Lab) |
| 1003 | pPvio-spaA-KO | Polysphondylium violaceum spaA knockout vector; parental vector: pLox-Neo III; insert length: 5.3kb; total vector length: 8.2kb; plasmid resistance marker (Dicty): Neo | Yoko Yamada (Pauline Schaap) |
| 791 | pPyr56-KO | Used to KO pyr56 gene (DDB_G0280041). Bacterial selection: amp; dicty selection: none (5FOA); parent pMfeI-tRNA (ochre), based on pBluescript II SK(-) | Rocio Benabentos (Shaulsky lab) |
| 795 | pQS31-tgrB1/tgrC1 | tgrB1/tgrC1 double gene replacement plasmid with tgrB1-QS31 and tgrC1-QS31 alleles, driven by QS31 promoter. Used to insert these alleles into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none (5FOA); parent pGEM3 | Rocio Benabentos (Shaulsky Lab) |
| 800 | pQS31-tgrB1/tgrC1-bsR | tgrB1/tgrC1 Merodiploid plasmid with tgrB1-QS31 and tgrC1-QS31 alleles, driven by QS31 promoter. Used to insert an extra set of tgrB1/tgrC1 alleles randomly in the genome. Bacterial selection: amp; dicty selection: bsR; parent pGEM3 | Rocio Benabentosx (Shaulsky Lab) |
| 796 | pQS38-tgrB1/tgrC1 | tgrB1/tgrC1 double gene replacement plasmid with tgrB1-QS38 and tgrC1-QS38 alleles, driven by QS38 promoter. Used to insert these alleles into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none (5FOA); parent pGEM3 | Rocio Benabentos (Shaulsky Lab) |
| 794 | pQS4-tgrB1/tgrC1 | tgrB1/tgrC1 double gene replacement plasmid with tgrB1-QS4 and tgrC1-QS4 alleles, driven by QS4 promoter. Used to insert these alleles into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none (5FOA); parent pGEM3 | Rocio Benabentos (Shaulsky Lab) |
| 799 | pQS4-tgrB1/tgrC1-bsR | tgrB1/tgrC1 Merodiploid plasmid with tgrB1-QS4 and tgrC1-QS4 alleles, driven by QS4 promoter. Used to insert an extra set of tgrB1/tgrC1 alleles randomly in the genome. Bacterial selection: amp; dicty selection: bsR; parent pGEM3 | Rocio Benabentos (Shaulsky Lab) |
| 797 | pQS45-tgrB1/tgrC1 | tgrB1/tgrC1 double gene replacement plasmid with tgrB1-QS45 and tgrC1-QS45 alleles, driven by QS45 promoter. Used to insert these alleles into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none (5FOA); parent pGEM3 | Rocio Benabentos (Shaulsky Lab) |
| 287 | pRacF2-G12V | Rho GTPase (RacF2) overexpression vector (constitutive active) | Tetsuya Muramoto (Hideko Ursushihara) |
| 288 | pRacF2-N17T | Rho GTPase (RacF2) overexpression vector (dominant negative). | Tetsuya Muramoto (Hideko Ursushihara) |
| 286 | pRacF2-WT | Rho GTPase (RacF2) overexpression vector | Tetsuya Muramoto (Hideko Ursushihara) |
| 507 | pRasG::bsr | Knockout vector for rasG | P. Bolourani (G. Weeks) |
| 587 | pRccA | plasmid to create rccA knock out mutant; parent plasmid: pBSR1 | Anupama Khare (Gad Shaulsky's lab) |
| 5 | pREMI:GFP-1 | REMI plasmid (neoR) for gene trapping, with GFP that can only be expressed from host promoter. | Petra Fey (Ted Cox) |
| 6 | pREMI:GFP-2 | REMI plasmid (neoR) for gene trapping, with GFP that can only be expressed from host promoter. | Petra Fey (Ted Cox) |
| 7 | pREMI:GFP-3 | REMI plasmid (neoR) for gene trapping, with GFP that can only be expressed from host promoter. | Petra Fey (Ted Cox) |
| 12 | pREP | Plasmid for cotransformation with pDXA/DXD series expression vectors. Pedigree: neoR cassette from pnDedeltaI removed by cutting with SacI/BamHI. | Menno Knetsch (Dietmar Manstein) |
| 802 | pRFP-GFP-Atg8 | The construct RFP-GFP-Atg8 was generated using GFP-Atg8 fragment amplified by PCR from the vector pA15/GFP-Apg8 (kindly deposited at the DSC by Grant OTTO). This fragment was then cloned in frame using XhoI site at the C terminus of the RFP protein from the vector pTX-RFPmars (kindly deposited at the DSC by Clement Nizak). | Ricardo Escalante |
| 303 | pRHI25 | Remi plasmid with truncated pyr5-6. Similar to pRHI30 but some of the PCR'd sequence was removed from the clone. Sequence note: the sequence below represents the insert only with coding in caps (Robert Insall). | Rob Insall |
| 27 | pRHI30 | Plasmid containing a truncated pyr5-6 region; Sequence note: the sequence below represents the insert only (Robert Insall). | Peter Devreotes |
| 84 | pRHI38 | Vector expressing the CRACWT gene. CRAC cDNA cloned into pRHI8, an expression vector derived from pATANB43 (pers. communic. R. Insall, 5/27/08). | Peter Devreotes |
| 353 | pRHI71 | RasGefA (aimless) in pRHI8, which is a Ddp1-based extrachromosomal vector. | Rob Insall |
| 457 | pRHI76 | Extrachromosomal expression vector. Aequorin inserted as BglII-NotI fragment between the constitutive actin15 promoter and the 2H3 terminator of pRHI8. | Mehreen Zaki (Rob Insall) |
| 459 | pRHI8 | Extrachromosomal expression vector. The BglII and NotI sites are too close to one another so it cuts badly. Use pRHI76 instead. | |
| 30 | pRJ525 | cAR3 in pBlueScript | Peter Devreotes |
| 83 | pRJ544 (5car3neo) | cAR3 knockout construct | Peter Devreotes |
| 82 | pRJ648 (5cAR3ura) | cAR3-KO vector | Peter Devreotes |
| 116 | pRNR-P | regulated expression vector based on the DNA-damage inducibility of the rnrB gene (ribonucleotide reductase promoter) | Adrian Tsang |
| 478 | pRNR-zyg1 | Inducible expression vector for overexpression of the zyg1 gene. | Aiko Amagai |
| 858 | pRoco5-REMI | roco5 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:1445173 | Christopher Quang Dung Dinh/Adam Kuspa |
| 181 | PSA/idq-galΔ5 | Harry MacWilliams (through Herb Ennis) | |
| 308 | pSadA-GFP | C-terminal GFP fusion | Petra Fey (Chisholm) |
| 882 | pSadA-REMI | sadA REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:1639241 | Christopher Quang Dung Dinh/Adam Kuspa |
| 836 | pSFGFP | SFGFP in 456-22 (minus GFP; HindIII-BamHI) | Annette Muller-Taubenberger |
| 928 | pSgkB-REMI | SgkB REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:2088746 | Christopher Quang Dung Dinh/Adam Kuspa |
| 884 | pSgmC-REMI | sgmC REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr3:5591567 | Christopher Quang Dung Dinh/Adam Kuspa |
| 1068 | pSigK/lacZ | The construct was made by sub-cloning the DDB_G0267476 promoter as a 655 bp XbaI/BglII fragment into XbaI/BglII restricted pDdGal-17. This fragment consists of the region -632_+24 bp from the DDB_G0267476 start and restriction sites. This includes the full intergenic region before DDB_G0267476. The construct drives the expression of β-gal when activated; parental vector: pDdGAI-17; vector length: 9137 bp. | Gillian Forbes (Schaap Lab) |
| 830 | pSma-KO | The plasmid was used to knock out the gene, DDB_G0281803/sma. The SMAko plasmid contains a 1Kb coding region and another 1Kb coding downstream of the first. A 500 bp sequence was left out between the two coding regions. The regions were inserted at EcoRI, HindIII and SpeI, SacII restriction sites into a pBluescript plasmid containing a floxed blasticidin resistance cassette previously inserted at a SmaI site. | Jessica Kelsey / Daphne Blumberg |
| 829 | pSma-mRFP | The plasmid was used for a knock-in gene replacement of DDB_G0281803/sma, such that the product would contain a C-terminal mRFP tag. The SMAmRFP plasmid contains a 3? coding region and a non-coding region sequence for promoting homologous recombination. The coding region is followed in frame by the mRFPmars coding sequence at the carboxy terminus of the protein. Following the mRFPmars coding region is a 270 bp AmpA terminator sequence. The plasmid also contains a floxed blasticidin resistant cassette inserted at the SmaI site for selection. | Jessica Kelsey / Daphne Blumberg |
| 49 | pspA-Gal (D19-Gal) | Construct drives the expression of beta-galactosidase as fusion protein containing the first five amino acids of PsA, under the control of a prespore promoter. | Jeff Williams |
| 345 | pspA/myc-fbxA | Myc-tagged FbxA under the control of the prespore pspA promoter, in a pDXA background. | Jakob Franke |
| 1005 | pSpaA-KO | spaA knockout vector; parental vector: pJet1.2blunt; insert length: 3.2kb; total vector length: 6.2kb | Yoko Yamada (Pauline Schaap) |
| 1006 | pSpaAp-spaA-YFP | spaA-YFP fusion vector expressed from the spaA promoter; parental vector: pExp4-Hyg; insert length: 5.2kb; total vector length: 10.6kb | Yoko Yamada (Pauline Schaap) |
| 603 | pTagB-BsR | REMI rescue construct from a tagB insertion mutant (insertion at position 2672 of the tagB coding region). Linearize with ClaI to use for homologous recombination | Anupama Khare (Gad Shaulsky) |
| 582 | pTagB/GFP(S65T) | GFP(S65T) expressed under the control of the tagB promoter | Danny Fuller (Loomis) |
| 606 | pTagB/lacZ | Dictyostelium expression vector, expressing lacZ under the tagB promoter. | Anupama Khare (Gad Shaulsky) |
| 390 | pTAP-Aur | Full-length DdAurora gDNA cloned in TAPGFP-tag vector for protein expression and purification in Dictyostelium. N-terminal TAPGFP tag; neoR. (by Hui Li) | Arturo De Lozanne |
| 391 | pTAP-Aur-KD | Expression construct for expressing kinase inactive form of TAPGFP-DdAurora(K139R) in Dictyostelium. N-terminal TAPGFP tag; neoR. (by Hui Li) | Arturo De Lozanne |
| 396 | pTAP-INCENP | Full-length DdINCENP cDNA cloned in TAPGFP-tag vector for protein expression and purification in Dictyostelium. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 397 | pTAP-INCENP-Δcs1 | The first 500 amino acids of DdINCENP cloned in TAPGFP-tag vector for protein expression and purification in Dictyostelium. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 591 | pTasAloxP-KO | plasmid for knocking out tasA in Polysphondylium pallidum; parent: pLoxNeoI (DSC: 589) | Yoshinori Kawabe (Pauline Schaap) |
| 599 | pTasB:Gal | This vector contains lacZ driven by TasB promoter | Yoshinore Kawabe (Pauline Schaap) |
| 593 | pTasBexp | Vector for expression of TasB under its own promoter | Yoshinore Kawabe (Pauline Schaap) |
| 592 | pTasBloxP-KO | plasmid for knocking out tasB in Polysphondylium pallidum; parent: pLoxNeoI (DSC: 589) | Yoshinori Kawabe (Pauline Schaap) |
| 307 | pten-KO-hyg | PTEN-knockout vector with hygromycin cassette. | Jane Borleis (Devreotes) |
| 403 | pTF169Cla | Plasmid popped out of DG1108 (acaA- remi mutant). The insertion in the gene was at the DpnII site at bp2575 relative to the ATG, with the T7 of BamHI-cut pBSR1 reading towards the 3-prime end of the gene. | Danny Fuller (Bill Loomis) |
| 404 | pTF169Eco | Plasmid popped out of DG1108 (acaA- remi mutant) with EcoRI. The insertion in the gene was at the DpnII site at bp2575 relative to the ATG, with the T7 of BamHI-cut pBSR1 reading towards the 3-prime end of the gene. | Danny Fuller (Bill Loomis) |
| 483 | pTF70-HindIII | Popout vector from the Remi mutant DG1047 (Cytochrome-P450 oxidoreductase - redA - knockout vector). Remi plasmid was pBSR3. | Danny Fuller (Loomis) |
| 1011 | pTgrB1 | tgrB1 from AX4 strain expression plasmid under native tgrB1 promoter; gene expression plasmid with tgrB1 promotor; parental vector: pLPBLP; | Shigenori Hirose (Adam Kuspa) |
| 1014 | pTgrB1ΔC-HA/tgrC1 | tgrB1/tgrC1 allele of AX4 replacement plasmid; tgrB1 has C-terminal tuncation (828-902) in cytosolic domain and HA tag; plasmid resistance marker (Dicty): pyr5-6 | Shigenori Hirose (Adam Kuspa) |
| 1013 | pTgrB1-HA/tgrC1 | tgrB1-tgrC1 allele of AX4 replacement plasmid; tgrB1 has C-terminal HA tag; plasmid resistance marker (Dicty): pyr5-6 | Shigenori Hirose (Adam Kuspa) |
| 778 | pTgrB1-hyg | Used to KO tgrB1 (DDB_G0280689). Bacterial selection: amp; dicty selection: hygR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 779 | pTgrB1/AX4:DEST- bsR | Destination vector (Invitrogen system) to insert any allele into the tgrB1 single gene replacement system, which would insert this allele into tgrB1 locus. Bacterial selection: amp and chloramphenicol; dicty selection: bsR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 780 | pTgrB1/AX4:tgrB1/AX4-bsR | tgrB1 single gene replacement plasmid with tgrB1-AX4 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 782 | pTgrB1/AX4:tgrB1/QS31-bsR | tgrB1 single gene replacement plasmid with tgrB1-QS31 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 783 | pTgrB1/AX4:tgrB1/QS38-bsR | tgrB1 single gene replacement plasmid with tgrB1-QS38 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 784 | pTgrB1/AX4:tgrB1/QS45-bsR | tgrB1 single gene replacement plasmid with tgrB1-QS45 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 781 | pTgrB1/AX4]:tgrB1/QS4-bsR | tgrB1 single gene replacement plasmid with tgrB1-QS4 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 792 | pTgrB1/tgrC1-KO-pyr56+ | Used to KO tgrB1 (DDB_G0280689) and tgrC1 (DDB_G0280531) and insert a pyr56 gene (DDB_G02800041) into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none; parent pRHI13 | Rocio Benabentos (Shaulsky Lab) |
| 1018 | pTgrB1:tgrB1 | tgrB1 from AX4 strain expression plasmid under native tgrB1 promoter; parent vector pLPBLP, bsR | Shigenori Hirose (Adam Kuspa) |
| 1016 | pTgrB1:tgrB1ΔC-HA | tgrB1 from AX4 strain expression plasmid under native tgrB1 promoter; the c-terminal cytosolic domain of tgrB1 (828-902) is truncated and HA-tag is added | Shigenori Hirose (Adam Kuspa) |
| 1017 | pTgrB1:tgrB1(AX4 - L864F) | tgrB1 from AX4 strain expression plasmid under native tgrB1 promotor; L846F mutation turns tgrB1 to constitutively active; restores tgrB1/tgrC1 double knockout phenotype | Shigenori Hirose (Adam Kuspa) |
| 1015 | pTgrB1:tgrB1(AX4)-HA | tgrB1 from AX4 strain expression plasmid under native tgrB1 promoter; HA tag is added at the C-terminal end | Shigenori Hirose (Adam Kuspa) |
| 1012 | pTgrC1 | tgrC1 from AX4 strain expression plasmid under native tgrC1 promoter; gene expression plasmid with tgrC1 promotor; parental vector: pLPBLP | Shigenori Hirose (Adam Kuspa) |
| 786 | pTgrC1/AX4:tgrC1AX4-bsR | tgrC1 single gene replacement plasmid with tgrC1-AX4 allele. Bacterial selection: amp; dicty selection: bsR; parent Plpblp | Rocio Benabentos (Shaulsky Lab) |
| 788 | pTgrC1/AX4:tgrC1QS31-bsR | tgrC1 single gene replacement plasmid with tgrC1-QS31 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 789 | pTgrC1/AX4:tgrC1QS38-bsR | tgrC1 single gene replacement plasmid with tgrC1-QS38 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 787 | pTgrC1/AX4:tgrC1QS4-bsR | tgrC1 single gene replacement plasmid with tgrC1-QS4 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 790 | pTgrC1/AX4:tgrC1QS45-bsR | tgrC1 single gene replacement plasmid with tgrC1-QS45 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 785 | pTgrC1/AX4]:DEST- bsR | Destination vector (Invitrogen system) to insert any allele into the tgrC1 single gene replacement system, which would insert this allele into tgrC1 locus. Bacterial selection: amp and chloromphenicol; dicty selection: bsR; parent pLPBLP | Rocio Benabentos (Shaulsky Lab) |
| 1019 | pTgrC1:tgrC1 | tgrC1 from AX4 strain expression plasmid under native tgrC1 promoter; plasmid resistance marker (Dicty): blasticidin | Shigenori Hirose (Adam Kuspa) |
| 870 | pTgrJ1-REMI | tgrJ1 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr2:646708 | Christopher Quang Dung Dinh/Adam Kuspa |
| 1056 | pTgrR1/LacZ | Reporter construct expressing β-galactosidase under control of the tgrR1 promoter; Parental vector: pDdGal-17; Insert length: 980 bp; Total vector length: 9.5 kb; dictyBase gene: tgrR1 (DDB_G0275745); Bacteria used: E.coli (XL1-Blue); | Koryu Kim (Schaap Lab) |
| 123 | pTIKL | Autonomous replicating extrachromosomal expression vector with G418 cassette. Same as pLittle but with 2 NcoI sites in the neoR cassette removed with site-directed muagenesis. | Tom Egelhoff |
| 831 | pTIKL-LMBD2B | The TIKLLMBD2B plasmid was used to create an overexpression of DDB_G0281669/LMBD2B. The plasmid contains the full length lmbd2B cDNA inserted at XbaI-SacI restriction sites into pTIKL-MyD. | Jessica Kelsey / Daphne Blumberg |
| 378 | pTIKL-MyD | Expresses full-length mhcA fused to actin15 promoter. MHC fragment from pMyD was excised as xbaI-SacI fragment and ligated into pTIKL. Made by Taro Uyeda. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 1072 | pTM1285(pyr56-sgRNA) | Used for CRISPR-Cas9 mediated knockout of the pyr56 gene. sgRNA sequence: 5? TATCAAAAGGTTTATAAATC 3? | Felicia Williams (Scaglione Lab) |
| 597 | pTopA-GFP | fusion of GFP to the first 35 amino acids of Dictyostelium DNA topoisomerase II (topA, aka top2mt), which targets the GFP to mitochondria; brightly labels mitochondria in Dictyostelium cells; construct made in pDXA-3H | Margaret Clarke |
| 26 | pTorA-B18 | TorA expression vector | Peter Devreotes |
| 189 | pTorA-GFP-B18 | Expression vector with GFP-labeled TorA (in the integrating vector pB18). | Peter Devreotes |
| 65 | pTorA-KO | TorA KO vector (in SP73) | Peter Devreotes |
| 947 | pTpp1-REMI | Tpp1 REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr1:3853350 | Christopher Quang Dung Dinh/Adam Kuspa |
| 115 | pTRAP1-RNAi MB38 | Dd-TRAP1 knockdown vector utilizing the tetracycline-regulated gene expression system (tet-off system) described by Blaauw et al., 2000 (pmid 10903439). | Yasuo Maeda |
| 220 | pTVKO4 | Construct used to generate ampA null mutant | Daphne Blumberg |
| 393 | pTX-Aur | Full-length DdAurora gDNA cloned in pTX-GFP for examination of subcellular localization of DdAurora. N-terminal GFP tag; neoR. (by Hui Li) | Arturo De Lozanne |
| 394 | pTX-Aur-KD | Expression construct for expressing kinase inactive form of GFP-DdAurora. The ATP-binding site Lysine139 was replaced by Arginine (Terada et al., 1998; Pmid: 9450992). N-terminal GFP tag; neoR. (by Hui Li) | Arturo De Lozanne |
| 377 | pTX-ecmA-YFP | YFP from citrine was amplified by PCR and cloned into the pTX vector after removal of the actin 15 promoter and insertion of the ecmA promoter. | Clement Nizak |
| 111 | pTX-FLAG | Dictyostelium extrachromosomal expression vector based on Ddp1 | Tom Egelhoff |
| 211 | pTX-FLAG-vwk | FLAG-labeled vwk (vWFA kinase) expression vector | Tom Egelhoff |
| 11 | pTX-GFP | GFP expression under control of the actin15 promoter (extrachromosomal vector based on Ddp1) | Tom Egelhoff |
| 210 | pTX-GFP-vwk | GFP-labeled vwk (vWFA kinase) expression vector | Tom Egelhoff |
| 399 | pTX-INCENP | Full-length DdINCENP (icpA) cDNA cloned in pTX-GFP for examination of subcellular localization of GFP-DdINCENP. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 401 | pTX-INCENP-ΔC | The first 1013 amino acids of DdINCENP, not including the IN-domain, cloned in pTX-GFP for the examination of the subcelluar localization of GFP-DdINCENP1-1013. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 398 | pTX-INCENP-Δcs1 | The first 500 amino acids of DdINCENP cloned in pTX-GFP for the subcelluar localization of GFP-DdINCENP1-500. N-terminal GFp tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 402 | pTX-INCENP-Δcs2 | The first 273 amino acids of DdINCENP cloned in pTX-GFP for the examination of the subcelluar localization of GFP-DdINCENP1-273. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 400 | pTX-INCENP-ΔN | The last 833 amino acids of DdINCENP, including the IN-box, cloned in pTX-GFP for the examination of the subcelluar localization of GFP-DdINCENP488-1320. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 634 | pTX-MKA1 | carries GFP fused to N-terminus of MHCKA, with actin 15 promoter | Tom Egelhoff |
| 636 | pTX-MKA2 | FLAG fusion at N-terminus of MHCKA, with actin 15 promoter | Tom Egelhoff |
| 632 | pTX-MKB1 | carries GFP fused to N-terminus of MHCKB, with actin 15 promoter | Tom Egelhoff |
| 637 | pTX-MKB2 | FLAG fusion at N-terminus of MHCKB, with actin 15 promoter | Tom Egelhoff |
| 633 | pTX-MKC1 | carries GFP at N-terminus of MHCKC, with actin 15 promoter | Tom Egelhoff |
| 635 | pTX-MKC2 | FLAG fusion at N-terminus of MHCKC with actin 15 promoter | Tom Egelhoff |
| 812 | pTX-NLS-Cre | Extrachromosomal Dictyostelium Cre expression vector for the removal of floxed Bsr-cassettes. | Joern Linkner / Jan Faix |
| 376 | pTX-PsA-CFP | ECFP from Clontech was amplified by PCR and cloned into the pTX vector after removal of the actin 15 promoter and insertion of the PsA promoter. | Clement Nizak |
| 112 | pTX-RFPmars | Dictyostelium extrachromosomal expression vector based on Ddp1. Cells are bright red. The RFP is derived from 339-3: mRFPmars in pBsrH (ID# 1). GFP of pTX-GFP was replaced with RFPmars of plasmid 339-3: RFP fragment of 339-3 obtained by cutting with BglII (blunted with Klenow) and BamHI. Inserted into pTX-GFP digested with SalI (blunted with Klenow) and BamHI. | Clement Nizak |
| 395 | pTX-TAPGFP | TAPGFP-tag vector for protein expression and purification in Dictyostelium. A TAP tag was inserted was inserted to the N-terminal of GFP in pTX-GFP. | Arturo De Lozanne |
| 41 | pUCBsrΔBam | REMI plasmid; Sequence note: The sequence of the terminator is missing and indicated by a poly-a. Note that only one of the Xba sites can be cut, allowing to obtain the famous Xba-Hind cassette (Pierre Cosson). | G. Shaulsky |
| 933 | pUdpB-REMI | UdpB REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr9:3914346 | Christopher Quang Dung Dinh/Adam Kuspa |
| 981 | pUniv_CKI_mEGFP | GFP knock-in module at the C-terminus of gene of interest; insert length: 2.2.5 kb; parental vector: pBluescript | Kazuki Horikawa |
| 982 | pUniv_CKI_mRFPmars | mRFPmars knock-in module at the C-terminus of gene of interest; insert length: 2.2 kb; parental vector: pBluescript | Kazuki Horikawa |
| 980 | pUniv_CKI_Turq2 | Turq2 knock-in module at the C-terminus on gene of interest; insert length: 2.2 kb; parental vector: pBluescript | Kazuki Horikawa |
| 100 | pUNK-KO | MHCK B knockout vector with bsR cassette | Tom Egelhoff |
| 1093 | pUPD2_E2A_TCGGGC_GGCTCG | GoldenBraid (doi.org/10.1093/nar/gkaa185)parts plasmid for cloning in the GoldenBraid system, contains F2A sequence with 5? TCGGGC and 3? GGCTCG overhangs; total vector length: 3038bp; parental vector: pUPD2; stored in NEB? Stable Competent E. coli | Allyson Sgro |
| 1094 | pUPD2_F2A_TCGGGC_GGCTCG | GoldenBraid (doi.org/10.1093/nar/gkaa185) parts plasmid for cloning in the GoldenBraid system, contains F2A sequence with 5? TCGGGC and 3? GGCTCG overhangs; total vector length: 3038bp; parental vector: pUPD2; stored in NEB? Stable Competent E. coli | Allyson Sgro |
| 1095 | pUPD2_mNeonGreen_AATG_GCTT | GoldenBraid (doi.org/10.1093/nar/gkaa185) parts plasmid for cloning in the GoldenBraid system, contains mNeonGreen sequence (codon-optimized for D. discoideum) with 5? AATG and 3? GCTT overhangs; total vector length: 3670bp; parental vector: pUPD2; stored in NEB? Stable Competent E. coli | Allyson Sgro |
| 1096 | pUPD2_mNeonGreen_AATG_TCGG | GoldenBraid (doi.org/10.1093/nar/gkaa185) parts plasmid for cloning in the GoldenBraid system, contains mNeonGreen sequence (codon-optimized for D. discoideum) with 5? AATG and 3? TCGG overhangs; total vector length: 3667bp; parental vector: pUPD2; stored in NEB? Stable Competent E. coli | Allyson Sgro |
| 1097 | pUPD2_mNeonGreen_CTCG_GCTT | GoldenBraid (doi.org/10.1093/nar/gkaa185) parts plasmid for cloning in the GoldenBraid system, contains mNeonGreen sequence (codon-optimized for D. discoideum) with 5? CTCG and 3? GCTT overhangs; total vector length: 3670bp; parental vector: pUPD2; stored in NEB? Stable Competent E. coli | Allyson Sgro |
| 1098 | pUPD2_mScarlet-I_AATG_GCTT | GoldenBraid (doi.org/10.1093/nar/gkaa185) parts plasmid for cloning in the GoldenBraid system, contains mScarlet-I sequence (codon-optimized for D. discoideum) with 5? AATG and 3? GCTT overhangs; total vector length: 3655bp; parental vector: pUPD2; stored in NEB? Stable Competent E. coli | Allyson Sgro |
| 1099 | pUPD2_mScarlet-I_AATG_TCGG | GoldenBraid (doi.org/10.1093/nar/gkaa185) parts plasmid for cloning in the GoldenBraid system, contains mScarlet-I sequence (codon-optimized for D. discoideum) with 5? AATG and 3? TCGG overhangs; total vector length: 3652bp; parental vector: pUPD2; stored in NEB? Stable Competent E. coli | Allyson Sgro |
| 1100 | pUPD2_mScarlet-I_CTCG_GCTT | GoldenBraid (doi.org/10.1093/nar/gkaa185) parts plasmid for cloning in the GoldenBraid system, contains mScarlet-I sequence (codon-optimized for D. discoideum) with 5? CTCG and 3? GCTT overhangs; total vector length: 3655bp; parental vector: pUPD2; stored in NEB? Stable Competent E. coli | Allyson Sgro |
| 1101 | pUPD2_P2A_TCGGGC_GGCTCG | GoldenBraid (doi.org/10.1093/nar/gkaa185) parts plasmid for cloning in the GoldenBraid system, contains P2A sequence with 5? TCGGGC and 3? GGCTCG overhangs; total vector length: 3029bp; parental vector: pUPD2; stored in NEB? Stable Competent E. coli | Allyson Sgro |
| 1102 | pUPD2_T2A_TCGGGC_GGCTCG | GoldenBraid (doi.org/10.1093/nar/gkaa185) parts plasmid for cloning in the GoldenBraid system, contains T2A sequence with 5? TCGGGC and 3? GGCTCG overhangs; total vector length: 3026bp; parental vector: pUPD2; stored in NEB? Stable Competent E. coli | Allyson Sgro |
| 945 | pUppA-REMI | UppA REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr5:3441051 | Christopher Quang Dung Dinh/Adam Kuspa |
| 53 | pV/63-Gal | ||
| 52 | pV18-bsr | V18 promoter driving BsR in pUC118 backbone. V18 promoter was amplified by PCR with downstream primer containing N-terminus of BsR up to Bgl2 site. PCR product was cloned in PBS SK- yielding pV18BsRN (no. 267). Removed again with Bgl2/Xba1 digestion and cloned into Bgl2/Xba1 restricted A15BsR (no. 134). | |
| 206 | pV18-I-S65T-GFP | V18 promoter driving ubi-I-s65tgfp in V18Tn5turbo background | Harry MacWilliams (via Stefan Pukatzki) |
| 571 | pV18-labile-luc | labile luciferase gene under control of the V18 (rpl11) promoter | Harry MacWilliams |
| 209 | pV18-VSon1-FLAG | Flag-tagged SonA cDNA | Jakob Franke (Stefan Pukatzki) |
| 973 | pV20066 | abcC8 knockout construct, parental plasmid pTZTN; transposon mediated mutagenesis; vector background available in the sequence section | Chris Dinh / Adam Kuspa |
| 324 | pV63gal | ||
| 1081 | pVac14-KO | Construct used for knockout of DDB_G0289233 (vac14);Inserts cloned into pLPBLP with KpnI/SalI (5' insert) and NdeI/BamHI (3' insert);parental vector: pLPBLP;insert lengths: 1.116 kb (5') + 1.108 kb (3');total vector length: 6.708 kb | Gillian Forbes (Schaap Lab) |
| 262 | pVATM-act6 | Vector for vatM promoter replacement. | Margaret Clarke |
| 118 | pVEII | inducible gene expression vector containing the discoidin gamma promoter; constructed by replacing the act6 promoter in pDnNeo2. Transformation vector which can be used for expression of genes from the discoidin I gamma promoter. The vector contains a multiple cloning site for inserting the gene of interest. The discoidin ATG is located upstream of the MCS. We recommend sequencing the junction of the insert using a primer within the promoter. The oligo: 5'-GAA AAA TTA AAA TTT CAT ACA AAT TAT C-3' worked well for us; you can start reading at the ATG - XbaI site. Regulation of the promoter is described in Vauti et al., Mol. Cell. BioI. 8, 4080-4088, 1990. The paper by Blusch et al., Nucl. Acids Res. 20, 6235-6238, 1992 describes use of pVEII as an inducible expression system. This has now been working for several people (e.g. M. Clarke, G. Weeks). In addition, Dictyostelium cells with altered discoidin expression can be used to get higher or lower expression. These mutant strains can be obtained from B. Wetterauer and H. MacWilliams (PMID 8464730 and PMID 8396055). Sequence note: This sequence has been provided by Piero Morandini and Klaus Salger. | Wolfgang Nellen |
| 261 | pVMop | G418-selectable transformation vector containing vatM driven by its own promoter. | Margaret Clarke |
| 887 | pVps13D-REMI | vps13D REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:4616863 | Christopher Quang Dung Dinh/Adam Kuspa |
| 60 | pVS | Expression vector with discoidin promoter (growing cells) for secretory proteins. G418 selectable. BglII and BamHI sites upstream of and downstream from a c-myc tag. | Chris West |
| 477 | pVS-Hyg | Expression vector with discoidin promoter (growing cells) for secretory proteins. Hygromycin selectable. BglII and BamHI sites upstream of and downstream from a c-myc tag. The SalI fragment (hygR cassette) from pDHGFP was cloned into the XhoI site of pVS4 (pVS clone 4). NruI and AfeI were used to remove most of the neoR cassette (personal commun. Chris West). | Chris West |
| 61 | pVSC | Expression vector with cotB promoter (prespore cells) for secretory proteins. G418 selectable. BglII and BamHI sites upstream of, and downstream from, a c-myc tag. | Chris West |
| 476 | pVSE | Expression vector with ecmA promoter (prestalk cells) for secretory proteins. G418 selectable. BglII and BamHI sites upstream of, and downstream from, a c-myc tag. Vector is derived from pVS4 by replacement of the discoidin promoter with the ecmA promoter. | Chris West |
| 443 | pVTL-AL | Dictyostelium reporter plasmid containing the AP-endonuclease (apeA) upstream sequence in front of the luciferase gene is inducible with bleomycin (DNA-damaging agent). | Rob Guyer (Deering) |
| 387 | pVTL2 | Autonomously propagating luciferase-encoding vector. | R. Guyer (R.A. Deering) (C. Rutherford) |
| 212 | pVWKA-KO1 | vwkA kockout vector | Tom Egelhoff |
| 849 | pXacC-REMI | xacC REMI plasmid; bacterial selection: amp; dicty selection: bsR; parent pBSRI; Insert location of chr4:3110471 | Christopher Quang Dung Dinh/Adam Kuspa |
| 78 | pYL23 | piaA knockout construct, made by replacing 0.4-kb EcoRI-HindIII fragment of the coding region with a vector carrying the URA selectable marker. | Peter Devreotes |
| 448 | pYL44 | piaA knockout vector made by Yu Long. EcoRI-XbaI 1.4-kb bsr cassette from pJH280 ligated with pYL23digested with ecoRI and XbaI (4.4 kb). | Jane Borleis (Devreotes) |
| 1082 | p[cdl1a]:cdl1a-YFP | Ddis cdl1a expression construct. D.discoideum cdl1A (DDB_G0286351) expressed from its own promoter and C-terminally fused to enhanced YFP in vector pBS17S-EYFP (prepared in C.J. Weijer lab from pDXAHC (Manstein et al., 1995)). Cdl1A-promoter cloned in with SalI/HindIII and cdl1A-coding sequence cloned in with BamHI/XhoI.; insert lengths: 3.1 kb cdl1A-promoter + 1.8 kb (3?) cdl1A coding; total vector length 11.339 kb | Gillian Forbes (Schaap Lab) |
| 260 | Rap1 | Rap1 overexpression vector (in pVEII) | Gerry Weeks |
| 256 | Rap1-G12V | Mutated Rap1 overexpression vector (based on pVEII) | Gerry Weeks |
| 255 | Rap1-S17N | Mutated Rap1 overexpression vector (based on pVEII) | Gerry Weeks |
| 512 | rasC rescue plasmid | rasC cDNA with rasC promoter plus G418 cassette for rasC-ko rescue. | P. Bolourani (G. Weeks) |
| 250 | RasC-bsr | Knockout vector for RasC | Gerry Weeks |
| 251 | RasC-thy | Knockout vector for RasC | Gerry Weeks |
| 509 | rasC::bsr (pJLW26) | Knockout vector for rasC | P. Bolourani (G. Weeks) |
| 515 | rasC::[GFP/rasC] | GFP-rasC expression construct under control of the rasC promoter. | P. Bolourani (G. Weeks) |
| 252 | RasG | RasG (wild type) overexpression vector (based on pVEII) | Gerry Weeks |
| 513 | rasG rescue plasmid | rasG genomic DNA plus G418 cassette for rasG-ko rescue. | P. Bolourani (G. Weeks) |
| 253 | RasG-G12T | Mutated RasG overexpression vector (based on pVEII) | Gerry Weeks |
| 254 | RasG-S17N | Mutated RasG overexpression vector (based on pVEII) | Gerry Weeks |
| 508 | rasG::thy1 | Knockout vector for rasG | P. Bolourani (G. Weeks) |
| 364 | RasGEFM-KO vector | RasGefM knockout vector | Salvo Bozzaro |
| 494 | RFP-Syntaxin7 | RFP-BamHI-Syntaxin7-stop-EcoRI (in pBsrH-RFPmars) An EcoRI site was introduced in the sequence by the silent A777G mutation. Decorates endocytic compartments and sometimes the contractile vacuole bladders. | Nelly Bennett |
| 496 | RFP-Syntaxin8 | RFP-BamHI-Syntaxin8-stop-EcoRI (in pBsrH-mRFPmars) Decorates the bladders and tubular network of the contractile vacuole. | Nelly Bennett |
| 495 | RFP-Vti1 | RFP-BamHI-Vti1-stop-EcoRI (in pBsrH-mRFPmars) Decorates the bladders and tubular network of the contractile vacuole. | Nelly Bennett |
| 249 | RIP3-KO | RIP3 knockout vector | Rick Firtel |
| 248 | RIP3-OE | RIP3 overexpression vector | Rick Firtel |
| 215 | rps4AS | Antisense construct for the mitochondial ribosomal protein S4 (RPS4) | Junji Chida (Yasuo Maeda) |
| 216 | rps4OE | Overexpression construct for the mitochondial ribosomal protein S4 (RPS4) | Junji Chida (Yasuo Maeda) |
| 58 | Scar-KO construct (p9A/O7C11) | Scar-KO construct (Scar-::Blast), isolated as suppressor of carB-null | Karl Saxe |
| 318 | sGCKO3486 | Pauline Schaap | |
| 3 | SL405 | PAKc KO construct. The BamHI blasticidin cassette was inserted in the BglII site created at position 560 of the PAKc cDNA, and a SpeI-XhoI fragment was ligated into pBluescript-SK. | Rick Firtel |
| 2 | SL515 | PAKb (mihck) KO construct. cDNA fragment 970-2057 was amplified, digested with XhoI (introduced) and EcoRI, and ligated in pBluescript-SK. The blasticidin cassette was inserted in the BamHI site at nt 1686. | Rick Firtel |
| 4 | SL516 | PAKb (mihck) KO construct for double null mutant. The BamHI hygromycin cassette was inserted in the BamHI site at position 1686 of the PAKb cDNA, and an EcoRI-XhoI fragment was ligated into pBluescript-SK. | Rick Firtel |
| 214 | SMEK OE | SMEK overexpression construct | Rick Firtel |
| 213 | smkA-KO | smkA knockout construct | Rick Firtel |
| 97 | srfA-KO | srfA knockout vector | Leandro Sastre |
| 1055 | tgrR1/LacZ | Reporter construct expressing β-galactosidase under control of the tgrR1 promoter; Parental vector: pDdGal-17; Insert length: 980 bp; Total vector length: 9.5 kb; dictyBase gene: tgrR1 (DDB_G0275745); Bacteria used: E.coli (XL1-Blue); | Koryu Kin (Schaap Lab) |
| 180 | V/63-I-S65T | emcA promoter driving semilabile GFP in V18TnDRE. The gfp has a protein half life of around 4 hours. The promoter is the entire original ecmA promoter and ultimately comes from 63-neo-gal (Jeff Williams). Constructed by Bgl2/XhoI shotgun from V/63-idq-gal in V18tn5 (no. 323) and Psa-I-s65tgfp in Sk- (no. 177). | Harry MacWilliams (through Herb Ennis) |
| 184 | V/63-idq-gal | Harry MacWilliams (through Herb Ennis) | |
| 179 | V/A15-GFP | Harry MacWilliams (through Herb Ennis) | |
| 182 | V/A6-gal | Harry MacWilliams (through Herb Ennis) | |
| 183 | V/PSA-gal | Harry MacWilliams (through Herb Ennis) | |
| 178 | V/PsA-I-S65T-GFP | Ligation of PsA-I-S65T and V18Tn5DRE. Constructed by Xba1/Xho1 shotgun starting from PsA-I-S65Tgfp in A6Tn5 (no. 190 and 63-ugus in V18Tn5DRE (no. 344). | Harry MacWilliams (through Herb Ennis) |
| 481 | VA6 | The expression vector VA6 was made by ligation of the XbaI-HindIII fragment of pDNeo2 (containing the actin 6 promoter and MCS) with the pRNR-P vector from which the the rnrB promoter was removed by digestion with XbaI and HindIII. | Aiko Amagai |
| 480 | VA6aco | Vector containing the actin 6 promoter upstream of the Dd-aco cDNA and the V18 promoter upstream of the neoR gene (Tn5). | Aiko Amagai |
| 482 | VA6aco RNAi | Dd-aco knockdown vector. | Aiko Amagai |
| 500 | VAMP7-GFP | BamHI-VAMP7-XhoI-GFP-NsiI-myc-stop (in pDXD-3C) | Nelly Bennett |
| 72 | YakA-GFP | GFP was fused to the C terminus of YakA, which was truncated by deleting the 190 C-terminal amino acids. | Peter Devreotes |
| 88 | YakA-KO | YakA knockout vector (8-kb religated BglII fragment of genomic DNA from REMI mutant, containing the plasmid pBSR3?) . | Peter Devreotes |
| Home| Contact dictyBase| Contact Dicty Stock Center Curators| SOPs| Site Map |
Supported by NIH (NIGMS and NHGRI)
|
